ID: 1023751654

View in Genome Browser
Species Human (GRCh38)
Location 7:43378840-43378862
Sequence TCAGGCAAGGGCAGAGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 512
Summary {0: 2, 1: 0, 2: 2, 3: 46, 4: 462}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023751654 Original CRISPR TCAGGCAAGGGCAGAGCAGC AGG Intronic
900226663 1:1536285-1536307 GGAGGAAAGGGCACAGCAGCGGG - Intronic
900660280 1:3778677-3778699 TCAGGAAAGGGCACAGCATGTGG + Exonic
900777003 1:4593059-4593081 TCAGGCATTGACTGAGCAGCAGG - Intergenic
900895824 1:5482246-5482268 CCAGGCAGGTGCAGAGCAGAGGG + Intergenic
900998935 1:6137889-6137911 CCAGGCAGGGGCAGGGGAGCAGG - Intronic
901051129 1:6426383-6426405 TCTGGCCAGTGCAGAGGAGCTGG + Intronic
901076066 1:6555420-6555442 GCAGGCAAAGGCCCAGCAGCAGG - Exonic
901167639 1:7231213-7231235 CCAGGCAAGGGCTGAGGAGGAGG + Intronic
901835825 1:11923376-11923398 TCAGGGAGGGGCTGAGCAGTGGG + Exonic
902869195 1:19303351-19303373 CCAGCCATGGGCAGGGCAGCAGG - Intergenic
903800539 1:25963995-25964017 TGAGCCAAGGGAAGAACAGCAGG + Intronic
904204228 1:28842363-28842385 CCAGGCAAAGCCAGAGCAGTTGG - Intronic
904246869 1:29194200-29194222 TCAGACAAGAGAACAGCAGCTGG + Intronic
904586682 1:31584629-31584651 GCAGGCCAGGGCAGAGCAGGAGG + Intronic
905082123 1:35332839-35332861 TCAGGCAAGTGCAGAGGTGCAGG - Intronic
905480710 1:38260064-38260086 TCTGGAAACGACAGAGCAGCTGG + Intergenic
905775748 1:40666009-40666031 TCAGGGCAGGGCAGGGCAGGGGG - Intergenic
905902686 1:41592178-41592200 TCCAGCAAGGGCAGATCAGGAGG + Intronic
906052843 1:42888645-42888667 TCATCCAAGAGCAGAGCCGCTGG - Intergenic
906659298 1:47571296-47571318 TAAGGAAGGGGAAGAGCAGCGGG + Intergenic
906674137 1:47681120-47681142 TCAGCCCAGGGCAGGGCAGGGGG - Intergenic
907043890 1:51287948-51287970 TTTGCCAAGGGCAGAGCAGGTGG - Exonic
907475439 1:54702164-54702186 TCAGGCCATGGAGGAGCAGCTGG + Exonic
907524572 1:55046692-55046714 CCAGGCCAGGGCAGAGCAAATGG - Intronic
908261704 1:62344193-62344215 TCAGGCAAAGGAAGAGAAGAGGG + Intergenic
908403290 1:63790735-63790757 ACAGGGAAGGGCAGAGCAACAGG - Intronic
908963537 1:69730057-69730079 TTAGCCAAGGCTAGAGCAGCTGG + Intronic
909104501 1:71391896-71391918 TCAGCCATGGCCAGAGCAGCTGG - Intergenic
909826030 1:80127840-80127862 TCAGCCATGGCCAGAGCAGCTGG + Intergenic
911375260 1:97044101-97044123 TCAAGTGAGGGCAGGGCAGCTGG + Intergenic
911428471 1:97752643-97752665 TCAGGAAAGGGAAGAGCATGTGG - Intronic
912163238 1:107011733-107011755 TCCTGTAAGGGCAGAGCAGGGGG + Intergenic
912475975 1:109935171-109935193 TCAGCCAAGGTCACAGCAGCTGG + Intergenic
915981141 1:160420557-160420579 ACAGGGAAGGGCAGAGGAGCAGG - Intronic
916280405 1:163045151-163045173 TGAGGCAAGAGTAGAGCAGCAGG - Intergenic
918136029 1:181674654-181674676 TCCTGCGAGGGCAGTGCAGCAGG + Intronic
919222095 1:194642564-194642586 TCAGCCATGGCGAGAGCAGCTGG - Intergenic
919794181 1:201311296-201311318 CAAGGCATGGGGAGAGCAGCTGG - Intronic
921164175 1:212494255-212494277 TCAGACACAGGCAGAGCAGTGGG + Intergenic
922593844 1:226798805-226798827 TCAGGAAACGGAGGAGCAGCAGG - Intergenic
922709161 1:227814106-227814128 TCAGCCATGGCTAGAGCAGCTGG + Intergenic
922757543 1:228105017-228105039 CATGGCGAGGGCAGAGCAGCAGG + Intronic
922765929 1:228156813-228156835 CCAGGAAAGGGCTGTGCAGCAGG - Intronic
922797024 1:228345296-228345318 TCAGTCATGGGCAGACCCGCGGG - Intronic
923034049 1:230271863-230271885 TCTGGGAAGGGAAGAGGAGCTGG - Intronic
923140087 1:231154081-231154103 GCAGGCCAGGGCAGCCCAGCTGG - Intergenic
923653709 1:235897566-235897588 GCAGGCAAAGACAGAGCAGGTGG - Intergenic
924329516 1:242927913-242927935 TCAGGCAAGGGGAGAGCCATGGG + Intergenic
924639803 1:245823267-245823289 TGGGGGAAGGGCAGAGAAGCAGG - Intronic
924727080 1:246681060-246681082 GAAGGGAAGGGTAGAGCAGCTGG + Intergenic
1062799429 10:368455-368477 GCAGGCAGAGGCAGAGCTGCGGG + Intronic
1062968308 10:1626968-1626990 TCAGGCAAGGAGAGGGCAGCAGG - Intronic
1062998989 10:1896314-1896336 CCACTCCAGGGCAGAGCAGCTGG + Intergenic
1063993674 10:11595288-11595310 CCAGGGCAGGACAGAGCAGCAGG + Intronic
1065509516 10:26464349-26464371 TCAGGCCTGGGCACAGCAACTGG - Intronic
1066058929 10:31705686-31705708 TCAGGCATGGGCTGTGGAGCTGG + Intergenic
1066636816 10:37511425-37511447 TCAGCCATGGCTAGAGCAGCTGG - Intergenic
1067090663 10:43264519-43264541 GCAGGGGAGGGCAGAGGAGCCGG + Intronic
1067247402 10:44558234-44558256 AAAGGCCAGGGCAGAGCAGGAGG - Intergenic
1069069993 10:63983236-63983258 TCAGTCATGGCCGGAGCAGCTGG - Intergenic
1069605773 10:69737769-69737791 TCAGGGGAGAGCAGAGCAGACGG + Intergenic
1069629222 10:69887813-69887835 TCAGGCACAGGCTGAGCTGCAGG - Intronic
1069724245 10:70567167-70567189 AGCGGCAATGGCAGAGCAGCAGG - Exonic
1070257067 10:74822092-74822114 TCAGTCAAGGGCAGAGGGGATGG - Intergenic
1070604615 10:77889997-77890019 TCAGGTATGGTCAGAGCAGCTGG - Intronic
1071283950 10:84127035-84127057 TCTGGAAAGGGCAGAGATGCAGG - Intergenic
1071483606 10:86082890-86082912 GCAGGCAAGGACAGAGCGGGTGG + Intronic
1071518827 10:86316458-86316480 TCAGGCATGTGCAGAGCTTCAGG - Intronic
1071940693 10:90588349-90588371 TCAGGGAAGGGAAGAGTAGGAGG - Intergenic
1072620912 10:97078705-97078727 TAAGGCAAGGGCACAGCAGCAGG + Intronic
1074320675 10:112399015-112399037 TCAGGCAAGGACAGACCACCAGG - Intronic
1076225673 10:128773108-128773130 TCAGCCATGGCTAGAGCAGCTGG - Intergenic
1076686726 10:132201532-132201554 CCAGGAAGGGGCAGACCAGCAGG + Intronic
1077107522 11:848513-848535 TCAGGGGTGGGCAGAGCTGCGGG + Intronic
1077439667 11:2562066-2562088 TAAGGCCAGGACAGGGCAGCCGG + Intronic
1077464271 11:2726167-2726189 GCTGGCCAGGGCAGAGGAGCAGG + Intronic
1078323445 11:10358036-10358058 TCAGGAAAGTCCTGAGCAGCAGG - Intronic
1078375895 11:10792715-10792737 ACGGGCAAGGGCAGGGCTGCGGG + Intergenic
1079086916 11:17452847-17452869 CAAGCCAAGGGCTGAGCAGCTGG + Intronic
1080741058 11:35064615-35064637 TCACGGAAGAGCAGAGAAGCTGG + Intergenic
1081797533 11:45831748-45831770 TGAGGCAAGGACAGAACATCAGG + Intergenic
1083311802 11:61787617-61787639 TCAGGATAGGGAAGAGCAGGGGG + Exonic
1083325636 11:61871725-61871747 TTAGCAAAGGGCACAGCAGCAGG - Intergenic
1083380671 11:62265809-62265831 TGAGGCAAGGGCAGAGGAGGAGG + Intergenic
1083932907 11:65855604-65855626 GCAGCCAAGGCCAGAGCAGAAGG + Intronic
1084267220 11:68011211-68011233 CCAGGCAGTGGCAGAGCAGGGGG + Intronic
1084525937 11:69698036-69698058 TGAGGAAAGGGCAGGACAGCAGG + Intergenic
1084549664 11:69833810-69833832 TCGGGTAAGGGGCGAGCAGCAGG + Intergenic
1084618758 11:70254010-70254032 ACAGGGAAGGCCAGATCAGCAGG + Intergenic
1084970385 11:72768313-72768335 TCAGGGAAGGGCAGAGTGGAGGG - Intronic
1085351830 11:75802658-75802680 GCAGTGAAGGGCAGAGCAGTAGG + Intergenic
1085507689 11:77069527-77069549 AGAGGCAAGGGCTGAGCAGCCGG + Intronic
1085765294 11:79276867-79276889 CCAGGATTGGGCAGAGCAGCTGG - Intronic
1085941850 11:81214240-81214262 TCAGCCATGGCTAGAGCAGCTGG + Intergenic
1087663823 11:101019312-101019334 TCTGGAAAGGGGAGAGGAGCTGG + Intergenic
1087906425 11:103703241-103703263 ACAGGCACTGGCAGAGTAGCAGG - Intergenic
1088766096 11:112980313-112980335 TCTTGGAAGGGCAGAGCTGCTGG - Intronic
1089304433 11:117517708-117517730 TGACCCAAGGGCAGAGGAGCAGG - Intronic
1089397278 11:118144677-118144699 TGAGGGAAGGGCTGAGAAGCTGG - Intronic
1090480179 11:127061110-127061132 TCAGCCATGAGCAGAGGAGCTGG + Intergenic
1090635083 11:128686091-128686113 GCAGGGAAGAGCAGCGCAGCTGG + Intergenic
1091200397 11:133775894-133775916 TCAGGCAGGGGTAGAGAAGTGGG + Intergenic
1091380095 12:52265-52287 TCAGTCAAGGTCAGAGCCACAGG + Intergenic
1091599963 12:1912153-1912175 TGAGGCCAGGGCCAAGCAGCAGG - Intronic
1091781143 12:3215301-3215323 GGAGTCAATGGCAGAGCAGCAGG - Intronic
1092109122 12:5946259-5946281 ACAGTCGAGGGCAGAGCAGAAGG + Intergenic
1092643060 12:10537862-10537884 TCAGCCACGGGTGGAGCAGCTGG + Intergenic
1092729033 12:11511137-11511159 GCAGGAGAGGGCAGAGCAGATGG - Intergenic
1092859685 12:12709888-12709910 TCAGACAAGGGGAGAGGAGGTGG - Intergenic
1093088174 12:14890011-14890033 TCAGGCATGGGAGGAGCATCTGG + Intronic
1094178012 12:27561629-27561651 TCAGGAGAGGTCAGAGAAGCTGG - Intronic
1095395598 12:41758793-41758815 TAAGGCAGGGGAAGAGCAGTTGG - Intergenic
1095989353 12:48023731-48023753 GGAGACAAGGGCAGAGCAGGTGG - Intronic
1096533463 12:52256369-52256391 TCAGGCCAGGAGAGACCAGCAGG - Intronic
1096620388 12:52861048-52861070 TCAGGGAAGAGCACATCAGCGGG - Intergenic
1096784687 12:54010183-54010205 TCTGGCTAGGGCAGAGCAACAGG - Intronic
1096797930 12:54090373-54090395 TCAGGTTAGGGCAGAGGTGCGGG - Intergenic
1097176353 12:57145638-57145660 TGAGGCAGGGGCAGAGCCACCGG + Intronic
1099490749 12:83284931-83284953 TCAGCCATGGCTAGAGCAGCTGG - Intergenic
1102025785 12:109713827-109713849 TCGGGCCAGAGCGGAGCAGCGGG + Intergenic
1103478869 12:121238134-121238156 TCAGGAAAGGCCAGACCAGTAGG + Exonic
1103977906 12:124715650-124715672 CCAGGCAAACGCTGAGCAGCAGG - Intergenic
1104605485 12:130184603-130184625 ACAGGGCAGGGCCGAGCAGCTGG - Intergenic
1106859926 13:33894536-33894558 TCAGCCAAGGGTACAGGAGCTGG + Intronic
1109990481 13:70048574-70048596 GCAGGCTAGGGTAGAGAAGCGGG + Intronic
1110318422 13:74135017-74135039 TCAGGCAGGGGCAGCCCCGCGGG + Intergenic
1112606436 13:100911224-100911246 TAAGGCAGGAGCAGAGCAGTTGG - Intergenic
1113185971 13:107686039-107686061 GCAAGCAAGGGTGGAGCAGCTGG + Intronic
1113474782 13:110572546-110572568 GCAGGCAAAGGCAGGGCAGATGG + Intergenic
1113578920 13:111414360-111414382 CCAGGCAAGGGCAGATGAGTGGG - Intergenic
1113728705 13:112624594-112624616 TCAGAAGAGGGAAGAGCAGCAGG + Intergenic
1113906098 13:113819888-113819910 GCAGGGAAGGTCAGGGCAGCCGG - Intergenic
1113930371 13:113965075-113965097 TCAGGCTAGGGCACAGAGGCTGG + Intergenic
1116122406 14:40737329-40737351 TTAGCCAAGGCTAGAGCAGCTGG - Intergenic
1116344241 14:43770320-43770342 CCAGGCAAGGGCATAGGAGAAGG - Intergenic
1117979021 14:61323226-61323248 AGAGGCAAGGGGAGAGCTGCGGG - Intronic
1118376826 14:65184687-65184709 TCTGGCAAGGGCAGAGTGGCAGG + Intergenic
1118460060 14:65979480-65979502 TCAGCCAAGGCTGGAGCAGCTGG - Intronic
1118860029 14:69655854-69655876 ACAGGCAAGGGAAGAGCAGTGGG - Intronic
1119783016 14:77290857-77290879 TCAGGCCAGGGCTGAGCAGTGGG + Intronic
1121430012 14:93879863-93879885 TGAGGAAAGGGCAGAGCAGCCGG - Intergenic
1121440580 14:93946427-93946449 TCAAGCAAGGGCAGAGAAGGGGG + Intronic
1121603954 14:95226946-95226968 TTTGGCAAGGTTAGAGCAGCTGG + Intronic
1122266978 14:100551160-100551182 ACAGGCAGGGGCAGGGGAGCAGG - Intronic
1124491868 15:30163144-30163166 TGAGGGAAGGCCAGGGCAGCTGG + Intergenic
1124751668 15:32375173-32375195 TGAGGGAAGGCCAGGGCAGCTGG - Intergenic
1125458069 15:39880813-39880835 TTAGGCAAGGGCATGGCAACAGG - Intronic
1125610041 15:40963731-40963753 ATGGGCAAGGGCAGACCAGCCGG + Intergenic
1126679611 15:51190488-51190510 TGTGGCAAGGCCAGAGCTGCGGG - Intergenic
1126782376 15:52149794-52149816 TCAGGACAGGGCCGGGCAGCTGG + Intronic
1127576281 15:60295380-60295402 TCAGCCAAGGCTGGAGCAGCTGG + Intergenic
1127943474 15:63725471-63725493 TGAGGTAATGGCAGACCAGCAGG + Exonic
1128177113 15:65565594-65565616 TCAGCCAAGGCTGGAGCAGCTGG + Intronic
1129343481 15:74901592-74901614 TCAGGCAAGGGTCTAGGAGCTGG + Exonic
1129891880 15:79076990-79077012 TCAGGCATGGGCAATGGAGCTGG + Intronic
1130327926 15:82896336-82896358 CCAGGCACAGGCAAAGCAGCCGG + Intronic
1130417788 15:83710234-83710256 TTAGTCAAGGGCAGAGGAGCAGG - Intronic
1131178648 15:90225470-90225492 TGAGGCAAGGGAGGAGAAGCTGG - Intronic
1132122780 15:99192431-99192453 TCAGCCAAGGCTGGAGCAGCTGG - Intronic
1132625079 16:887792-887814 TCAGGCAGGGGCAGTGCTTCCGG + Intronic
1133424097 16:5672616-5672638 CCAGGAAAAGGCAGAGCAGTGGG + Intergenic
1134124935 16:11610085-11610107 TCAGGGAAGCACAGAGAAGCTGG + Intronic
1134531691 16:14989017-14989039 TCAGGGAGGGGCTGAGCAGCGGG + Intronic
1135588597 16:23689839-23689861 TCCTGCAAGAGAAGAGCAGCAGG - Exonic
1135926042 16:26694935-26694957 TCAGCCATGGCCAGATCAGCTGG + Intergenic
1136012064 16:27370168-27370190 TGTGCCCAGGGCAGAGCAGCAGG - Intergenic
1137381679 16:48005140-48005162 TGAGGCACAGGCAGAGGAGCTGG - Intergenic
1138069130 16:53973257-53973279 TCCGACAAGGGGAGAGCATCTGG - Intronic
1138163832 16:54781133-54781155 TCAGGCAAAGACAGAGAAGAGGG + Intergenic
1138273401 16:55712387-55712409 TCAGGCCAGGGAAGAGGAGAGGG - Intergenic
1138417474 16:56879600-56879622 GCAGGCCAGGGCAGAGGAGAGGG - Exonic
1138534601 16:57653264-57653286 TCAGGAACTGGCTGAGCAGCTGG - Exonic
1139440562 16:66964571-66964593 TCAGAGGAGGGCAGAGGAGCTGG - Intronic
1139473192 16:67189142-67189164 GCAGGAGCGGGCAGAGCAGCTGG - Exonic
1139526312 16:67518827-67518849 GCAGACAAGGGCAGAGAAGGGGG + Intronic
1140848506 16:78912516-78912538 TCAGGGAAGAGCGGAGGAGCTGG - Intronic
1141212632 16:81995329-81995351 TGAGGCAAGGTGAGGGCAGCTGG + Exonic
1141289707 16:82706427-82706449 TCATGCCAGGGCAGAGTAGAAGG + Intronic
1141963792 16:87427249-87427271 TCAGGCATTGCCAGAGCAGCAGG - Intronic
1142377267 16:89712385-89712407 TGAGCCAAGGGCAGAGAAGGGGG - Intronic
1142672174 17:1492313-1492335 TCGGGCAAGAGCTGAGCAGCGGG - Intronic
1143669178 17:8384419-8384441 TGAGGCAGCGGCAGTGCAGCAGG + Intergenic
1144349296 17:14379151-14379173 ACAGGAAAGGGCAGAGCTGTTGG + Intergenic
1144517310 17:15927726-15927748 CCCAGCAAGGGCAGAGCAGATGG + Intergenic
1144538544 17:16115175-16115197 TCAGCCATGGCCAGAGCTGCTGG + Intronic
1144819860 17:18064833-18064855 GCAGGAGAGGTCAGAGCAGCCGG + Intronic
1144866915 17:18341827-18341849 TCATGGAAGGGCAGAGCATCTGG + Intronic
1145270499 17:21402159-21402181 TGAGGCCAGGGGAGGGCAGCGGG - Intronic
1145286087 17:21506780-21506802 GAAGGCAAGGGGCGAGCAGCAGG - Intergenic
1145308708 17:21689556-21689578 TGAGGCCAGGGGAGGGCAGCGGG - Intergenic
1145391519 17:22459511-22459533 GAAGGCAAGGGGTGAGCAGCAGG + Intergenic
1147006279 17:37406724-37406746 TCGGGCACGGGGACAGCAGCAGG + Intronic
1148088915 17:45010865-45010887 CCAGGCAAAGGCAGAGAGGCTGG + Intergenic
1149110238 17:53019510-53019532 TCAGCCACAGGTAGAGCAGCTGG + Intergenic
1149304780 17:55336898-55336920 GCATCCAAGGGCTGAGCAGCAGG + Intergenic
1149341553 17:55691869-55691891 ACTGTCAAGGGCAGAGTAGCTGG - Intergenic
1150148299 17:62789406-62789428 AGAGGCAAGGCCACAGCAGCAGG - Intronic
1150429244 17:65102110-65102132 CCAGCCAATGGCAGAGCTGCAGG + Intergenic
1151327529 17:73388330-73388352 TCAGGCAGGAGCAAAGGAGCTGG - Intronic
1151386519 17:73758440-73758462 TGAGGCAAGTGCAGAGCCCCTGG - Intergenic
1151419843 17:73989999-73990021 TCAGGCAAGGGCACTCCAGAGGG - Intergenic
1151465621 17:74283026-74283048 TCTGGAAAAGGCAGAGCTGCTGG - Intronic
1151738266 17:75960284-75960306 CCAGGCAACTGCGGAGCAGCAGG - Exonic
1152365933 17:79856289-79856311 TCAGGGAATGGAAGAGAAGCGGG - Intergenic
1152479210 17:80538673-80538695 CAAGACAAGGGCAAAGCAGCTGG - Intergenic
1152735751 17:81996062-81996084 TCAGGTAAGGGCAGTGCTGCTGG + Exonic
1153421937 18:4916747-4916769 TTAGCCAAGGCCAGAGCAACCGG + Intergenic
1153846053 18:9050891-9050913 TTAGCCAAGGTCAGAGCAGCTGG - Intergenic
1155236608 18:23826124-23826146 TCAGGAAAGAGCAGAGCTGCAGG - Intronic
1155321958 18:24628331-24628353 TCTGGCAAGGGAATGGCAGCAGG + Intergenic
1155521238 18:26671194-26671216 TCACAGAAGGGCAGAGCAGAGGG + Intergenic
1158081778 18:53601028-53601050 TCATGGAAAGGCAGAACAGCAGG - Intergenic
1159193984 18:65087272-65087294 TAAGCCAAGGGCAGATCACCTGG - Intergenic
1160444217 18:78914524-78914546 TCAGGCAAAGGCACAACAGGCGG - Intergenic
1161587677 19:5114351-5114373 ACAGGCCAAGGCAGAGCAGGAGG - Intronic
1162902732 19:13805085-13805107 TCAGCCAAGCGCTGAGCAGTGGG - Exonic
1163798287 19:19349590-19349612 GCAGGCAGGGCCAGAGGAGCTGG + Intronic
1164822356 19:31260033-31260055 TCAGCACAGGGCAGAGCAGAAGG - Intergenic
1165057294 19:33185891-33185913 TCAGCCAAGCTCAAAGCAGCTGG - Intronic
1165181786 19:33977954-33977976 TCAGGAAAGGGCACAGCTCCAGG + Intergenic
1165230519 19:34383686-34383708 TGAGGCAAGGACAGGGGAGCTGG + Intronic
1167290774 19:48624322-48624344 TCAGCCAATGGCCGTGCAGCCGG - Intronic
1167394130 19:49216502-49216524 ACAGGCAATGGCAGTGCATCAGG + Intergenic
1167524027 19:49972662-49972684 TGAGGCAGAGGCAGAGAAGCAGG - Intergenic
1167719891 19:51172127-51172149 TGAGGCAAAGGCAGAGAAGCAGG - Intergenic
1167726240 19:51215091-51215113 TGAGGCAGAGGCAGAGAAGCAGG - Intergenic
1168497656 19:56867366-56867388 TTAGGCAAGGGGAGGACAGCAGG + Intergenic
1168550673 19:57290734-57290756 TCAGGCAAGGCCAGATGAGAAGG - Exonic
925811221 2:7702794-7702816 TCAGGGCAGGGCAGAGCACGGGG + Intergenic
926118030 2:10225547-10225569 TCAGGAGAGGGCAGGGGAGCAGG - Intergenic
926246225 2:11123857-11123879 TCAGGCAGGGGCAATCCAGCGGG - Intergenic
926253148 2:11167597-11167619 TCATGCAAGGGCTGAACACCAGG + Intronic
926976663 2:18522715-18522737 TGAGGACAGGGCAGAGCTGCAGG - Intergenic
927108973 2:19850850-19850872 TTAGGATAGGGCAGAGCAGAGGG - Intergenic
928007896 2:27580267-27580289 TCAGGCGAGGACAACGCAGCAGG + Exonic
929280909 2:40077509-40077531 TCAGGAACAGCCAGAGCAGCAGG + Intergenic
929657907 2:43752463-43752485 GCAGGGAAGGGGAGGGCAGCAGG - Intronic
930690093 2:54353310-54353332 TGAGGCAAGGGCAGGGTGGCAGG + Intronic
931119355 2:59199192-59199214 TTAGCCATGGCCAGAGCAGCTGG - Intergenic
931693959 2:64858544-64858566 ACAGGAAAGATCAGAGCAGCTGG - Intergenic
931848335 2:66228178-66228200 TCAGGCTGGGGCAGAGCTGATGG - Intergenic
932023936 2:68115049-68115071 ACAGGCCAGGGGAGATCAGCTGG - Intergenic
932031646 2:68192926-68192948 TCAGGCAAGGCCATTCCAGCAGG - Intronic
932716897 2:74107238-74107260 GCAGGCAAGAGCAGAGCAATAGG + Exonic
932808602 2:74805155-74805177 TCAGGCAAGGTCAATGCTGCTGG - Intergenic
933765575 2:85706396-85706418 TCAGGCAGCGGCAGGGCACCTGG + Intergenic
933902442 2:86859724-86859746 GCAGGCCAGGGCAGAGATGCAGG + Intronic
935175143 2:100642684-100642706 TCAGGGATGGGCACAGCAGTGGG - Intergenic
935657626 2:105438508-105438530 ACTGACAAGGGCAGCGCAGCTGG - Intronic
935778105 2:106489544-106489566 GCAGGCCAGGGCAGAGACGCAGG - Intergenic
936487904 2:112942486-112942508 TCAGGCAATGGGAGATCAGAGGG + Intergenic
937072469 2:119074499-119074521 GCAGGGAAGGGCAGAGGACCAGG - Intergenic
938249590 2:129804422-129804444 TCAGGCTGGGGCAGGGTAGCGGG + Intergenic
938251201 2:129817021-129817043 CCAGGAAAGGGCAGAGGAGCTGG + Intergenic
939003466 2:136761125-136761147 GCAGGCAGGGGCAGAGGGGCAGG - Intergenic
939752449 2:146064189-146064211 TCAGCCAAGGCTGGAGCAGCTGG + Intergenic
940270337 2:151883175-151883197 TGAGGTAAGGGAAGAGCAGCTGG + Intronic
942186317 2:173428017-173428039 TCCTGCCAGGGCAGAGCACCTGG - Intergenic
942408924 2:175686046-175686068 TCAGGCAATGGCAATGCTGCAGG + Intergenic
944445072 2:199780815-199780837 CCAGGAAAGGGCAGAGGAGCTGG - Intronic
944613898 2:201440399-201440421 TCAGCCAAGGGCAGAAAAACAGG - Intronic
944868313 2:203883961-203883983 CCAGGCAATGGCAGACCTGCTGG - Intergenic
945709462 2:213278030-213278052 TCAGCCACGGCTAGAGCAGCTGG - Intergenic
946209172 2:218133666-218133688 TGTGGCAAGGGCAGAGCCCCAGG + Intronic
946368715 2:219267031-219267053 TCAGACAAAGGCACAGCAGATGG - Intronic
946492957 2:220167772-220167794 TCAGGCCTGGGAAGAGGAGCAGG + Intergenic
946522658 2:220483660-220483682 TCAAGCAATGGCAGAGTAGGTGG - Intergenic
946622403 2:221573438-221573460 TCCGGCGAAGGCAGCGCAGCCGG + Intronic
948035159 2:234852575-234852597 TGAGGAAAGGGCAGGGCAGATGG - Intergenic
948243144 2:236455366-236455388 CCAGGCAAGGGCACAGCACCAGG - Intronic
948357765 2:237393653-237393675 TCAGCGATGGGCAGAGCAGAGGG - Intronic
948755331 2:240156284-240156306 CCAGGCAATGGCAGAACAGCAGG - Intergenic
1168842425 20:917907-917929 GCAGGCAAAGGAAAAGCAGCTGG + Intergenic
1169022382 20:2339799-2339821 GCAGGCAGGGGCTGAGCAGCTGG + Intronic
1169155699 20:3327877-3327899 CCAGGCAAGGGCAGGGCAGAGGG + Intronic
1169683678 20:8246241-8246263 TCTGGTAAGGGCTTAGCAGCAGG + Intronic
1169806205 20:9561890-9561912 TCAGGCAATGGCAATGCTGCTGG - Intronic
1170536823 20:17348941-17348963 TTAGCCAAGGGCAGAGCCACGGG - Intronic
1170589028 20:17757192-17757214 TCAGGCATGAGCAGTGCAGCAGG - Intergenic
1171849767 20:30300198-30300220 TCAGGTTAGGGCAGAGGTGCGGG - Intergenic
1173808260 20:45940355-45940377 TTAGGGAAGAGCAGAGGAGCTGG - Intronic
1173821722 20:46023921-46023943 GAAGGCAAGGGTAGAGAAGCAGG - Intronic
1173855858 20:46250495-46250517 GCAGGAAAGGGCAGTTCAGCAGG + Intronic
1173904902 20:46619388-46619410 TTAGTCAAGGGCAGTGCAGATGG - Intronic
1174087317 20:48018508-48018530 TCAGGCATGGGAAGAGGAGTGGG - Intergenic
1174295086 20:49540093-49540115 TCAGCCATGGGCAGAGCAGAGGG + Intronic
1174969778 20:55261950-55261972 TCAGGAAAGGACAGAGCTGTAGG + Intergenic
1175466297 20:59192808-59192830 GCCGGCAAGGGCAGAGCGGGCGG + Exonic
1175925892 20:62471163-62471185 CCAGGGCAGGGCAGGGCAGCAGG + Intronic
1176035786 20:63035831-63035853 TGAGGGCAGGGCAGAGCAGGAGG + Intergenic
1176117414 20:63439157-63439179 GCAGGGCAGGGCAGGGCAGCTGG - Intronic
1176243198 20:64084412-64084434 TCAGCCGATGGCAGAGCTGCTGG - Intronic
1176673054 21:9751999-9752021 TCAGGGAAGGGGAGATCTGCGGG - Intergenic
1176673087 21:9752109-9752131 TCAGGGAAGGGGAGATCCGCGGG - Intergenic
1178815113 21:35922233-35922255 TCAGAGAAGGGCAGAGAATCTGG - Intronic
1179218440 21:39386491-39386513 ACCGGCAAGGGCGGAGAAGCGGG - Intronic
1179644354 21:42766631-42766653 GCAGGCAAGGGCTGGACAGCAGG + Intronic
1179794549 21:43775385-43775407 TCTGGCAGGCGCAGAGCAACAGG + Intronic
1179873942 21:44258129-44258151 TCAGACAAAGGCAGAGAAGGTGG - Intronic
1180002578 21:45002013-45002035 TCTTGCAAGGACAGACCAGCTGG - Intergenic
1180054228 21:45348892-45348914 CCAGGCCAGGGCAGAACAGTGGG + Intergenic
1181443127 22:22948871-22948893 TGAGGCAGGGGCAGCACAGCCGG + Intergenic
1181967318 22:26666356-26666378 TCAGGAAAGGGCAGGGGAGAAGG + Intergenic
1181983118 22:26780478-26780500 TCAGCCAAGGGCAGACCAGGAGG + Intergenic
1182354103 22:29714489-29714511 GCAGGGCAGGGCAGGGCAGCAGG + Intergenic
1182693020 22:32176574-32176596 TCAGGCCAGGGCGGGGCCGCGGG + Intergenic
1182779751 22:32858252-32858274 TTAGGCCAGGGCAGAGGGGCAGG + Intronic
1183389308 22:37535902-37535924 TCAGCCCATGGCAGAGAAGCAGG - Intergenic
1183737041 22:39649922-39649944 GCAGGCCAGTGCAGCGCAGCCGG + Exonic
1183740321 22:39665294-39665316 CCAGACACGGGCAGAGCAGGAGG - Intronic
1184551020 22:45204167-45204189 TGGGGCAGGGGCTGAGCAGCAGG + Intronic
1185154076 22:49182833-49182855 GCCGGCAAGGGCTGAGGAGCTGG + Intergenic
950261119 3:11543995-11544017 GCAGGGAAGGCCAGAGCAGATGG - Intronic
950684247 3:14605159-14605181 TAAGGGAGGGGCAGATCAGCAGG + Intergenic
952495860 3:33915169-33915191 ACAGTCAAGGGCAGTGCAACGGG + Intergenic
953538117 3:43791239-43791261 CTGGGCAAGGGAAGAGCAGCTGG - Intergenic
953761256 3:45689169-45689191 TTGGGGAAAGGCAGAGCAGCGGG - Intronic
954139660 3:48598381-48598403 CCAGGCAAGTCCAGAGCTGCTGG - Intergenic
954403409 3:50331482-50331504 GCATGCAGGGGCTGAGCAGCTGG - Intronic
954454634 3:50591080-50591102 TCAGGCGAGGACACAGCATCTGG + Intergenic
954503336 3:51042584-51042606 TCTGGCCAGGGCAGTCCAGCAGG + Intronic
956311134 3:67881796-67881818 TGAGGCAAGTTCAGAGCATCAGG + Intergenic
956653166 3:71523864-71523886 TCGAGGGAGGGCAGAGCAGCCGG + Intronic
957873093 3:86112598-86112620 TTAGCCAAGGCTAGAGCAGCTGG - Intergenic
958653920 3:96977037-96977059 TCAGGTAAGGGCAAAGAAGTGGG + Intronic
958911146 3:99995806-99995828 TCAGCAATGGCCAGAGCAGCTGG + Intronic
959973398 3:112431901-112431923 TCAGCCACGGATAGAGCAGCTGG - Intergenic
961437153 3:126927204-126927226 GCTGGCAAGCGCAGGGCAGCAGG + Intronic
961603663 3:128078129-128078151 CCAGCCCTGGGCAGAGCAGCTGG - Intronic
962827284 3:139109037-139109059 TTTCTCAAGGGCAGAGCAGCTGG - Intronic
964041732 3:152269142-152269164 TCAGCCACGGGCAGACCCGCCGG - Intronic
964747554 3:160026495-160026517 TCAGGAAAGGGCAGTTCAACTGG - Intronic
965787483 3:172351414-172351436 TCAGTAAAGGGGAGAGTAGCAGG + Intronic
965968935 3:174529787-174529809 TCAGCCACGGCTAGAGCAGCAGG + Intronic
966027052 3:175296894-175296916 AGAGGCAATGGAAGAGCAGCAGG + Intronic
966325272 3:178746331-178746353 TCAGCCATGGCTAGAGCAGCTGG + Intronic
967486410 3:190036767-190036789 TCGCTCAAGGGCAGAGCAGAGGG - Intronic
968224713 3:196966571-196966593 TCTGTCAAGGACAGAGCAGGAGG + Intronic
968626757 4:1629345-1629367 TCAGGCCAGGCCAGACCACCCGG + Intronic
968696551 4:2032935-2032957 TCCGGCAAGGGCACAGGAGTGGG - Intronic
968818594 4:2834172-2834194 CCAGGCAGGGCCAGGGCAGCTGG + Exonic
968940193 4:3633670-3633692 CCAGGCCGGTGCAGAGCAGCAGG - Intergenic
969214482 4:5711214-5711236 GCAGGGAAGGGGAGAGAAGCAGG + Exonic
970436242 4:16038078-16038100 TCATACAAGGGCAGAGCCGGTGG - Intronic
970548707 4:17156811-17156833 TCTGATGAGGGCAGAGCAGCTGG - Intergenic
971077078 4:23162327-23162349 CCAGGCAAGAGCAGAGAAGTAGG - Intergenic
971362834 4:25952873-25952895 TCAGTCCAGAGCACAGCAGCAGG - Intergenic
972324555 4:38003092-38003114 CCAGGCAATGGCAGAACAGTAGG - Intronic
974020100 4:56685503-56685525 TCAGCCAATGGCAGAGAACCTGG + Intergenic
977977719 4:103286646-103286668 TCAGCCATGACCAGAGCAGCTGG - Intergenic
978651555 4:111011622-111011644 GCAGAGGAGGGCAGAGCAGCAGG - Intergenic
978940803 4:114434366-114434388 TCAGGCAACTCCAGTGCAGCAGG - Intergenic
981112636 4:140953430-140953452 CCTGGCAAGGGCAGAACAGATGG + Intronic
982061034 4:151604314-151604336 TCAGGAAAGAGCAGGGAAGCAGG - Intronic
982429993 4:155312075-155312097 TAGGGGAAGGACAGAGCAGCAGG - Intergenic
982507899 4:156242547-156242569 TCACCCAAGGGTACAGCAGCTGG + Intergenic
983047671 4:163006081-163006103 TCAGTCATAGGCAGAGCAGCTGG + Intergenic
985148444 4:186919536-186919558 GCAGGCCTGGGCAGAGCGGCTGG - Intergenic
985406024 4:189639293-189639315 TCAGGCAGGGGGAAAGCAGAAGG - Intergenic
985590074 5:759942-759964 GCAGGCATGGGGAGTGCAGCCGG + Intronic
986081131 5:4395223-4395245 TCAGCCATGGCTAGAGCAGCTGG + Intergenic
986593046 5:9391307-9391329 TGAGGCAGGGGCAGAGGGGCAGG + Intronic
987810227 5:22825645-22825667 TCAGGCAAGGGTAGATCATGTGG + Intronic
988705854 5:33725375-33725397 TCAGGCAGGGGAGGAACAGCTGG - Intronic
989400238 5:41000629-41000651 TCAGCCATGGGGAGAGCAGGAGG + Intronic
990048047 5:51458710-51458732 TCAGAAATGGCCAGAGCAGCTGG + Intergenic
990492498 5:56316024-56316046 TCAGGTAAGGGCAGAGTTTCTGG + Intergenic
991223608 5:64243616-64243638 TCACCCTAGGACAGAGCAGCTGG + Intronic
992718407 5:79534283-79534305 ACAGTCCAGGGCAGAGCAGGGGG - Intergenic
993067504 5:83117879-83117901 CCAGGCAAGGGGAGAGCACCAGG - Intronic
993421296 5:87704021-87704043 TCATGAAAAGGCAGAGAAGCAGG - Intergenic
994084866 5:95747147-95747169 TCAGACAAGGGCTGAGCCCCTGG - Intronic
994147521 5:96411591-96411613 ACAGGCACGTGCAGAGCAGAAGG + Intronic
994619512 5:102146384-102146406 CCATGCAAGGGCACAGAAGCTGG - Intergenic
995312715 5:110731638-110731660 TCAGCCATGGCCGGAGCAGCTGG + Intronic
996030945 5:118703349-118703371 TCAGCCAAGGCTGGAGCAGCTGG + Intergenic
996088939 5:119331583-119331605 CCAGGCAAGGGCAGAGGACATGG - Intronic
996222797 5:120953714-120953736 TCAGCCAAGGCTGGAGCAGCTGG - Intergenic
996617378 5:125457871-125457893 TCAGCCAAGGCTGGAGCAGCTGG - Intergenic
997594314 5:135096006-135096028 TCAGGCATGGCCAGTGCAGCAGG + Intronic
997720803 5:136077089-136077111 TCAGGACCAGGCAGAGCAGCTGG - Intergenic
998565418 5:143212148-143212170 TGAGGACAGGGCAGAGCAGGTGG - Intronic
998997291 5:147879573-147879595 TCAGGTAAGGGTATAGAAGCTGG + Intronic
999368576 5:151038942-151038964 GGAGGCAATGGCAGAGCAGGCGG + Intronic
999893116 5:156000418-156000440 TCAGAGAAGGGCTGAGCAGAGGG + Intronic
1000541861 5:162550439-162550461 ACAGGCACGGGCACACCAGCAGG + Intergenic
1001584980 5:172827767-172827789 TTAGTCAAGGGGAGAGAAGCAGG - Intergenic
1001683673 5:173576902-173576924 TCAGGGAAGGACAGATGAGCAGG + Intergenic
1001842216 5:174887634-174887656 CCAGGCCAGAGCAGAGCAGGTGG - Intergenic
1002283571 5:178147707-178147729 TCTGGGAAGGGCAGCGAAGCGGG - Exonic
1002425323 5:179171526-179171548 CCAGAGAAGGGCACAGCAGCGGG + Intronic
1002843336 6:924430-924452 ACAGGCACGGGCAGGCCAGCAGG + Intergenic
1003220582 6:4157557-4157579 TCGGGCAAGAGCGGGGCAGCTGG + Intergenic
1003324849 6:5084330-5084352 CCTGGCAAGGCCGGAGCAGCAGG + Intergenic
1003650025 6:7950994-7951016 TGAGGCCTGGTCAGAGCAGCAGG + Intronic
1005953355 6:30647258-30647280 GCAGGCAAGGGCCGAGACGCCGG - Exonic
1006413832 6:33892018-33892040 GCGGGCAAGGGCAGAGTAGGAGG + Intergenic
1006791542 6:36704361-36704383 TCAGGCAGCGGCAGAACTGCAGG + Exonic
1009701741 6:67193149-67193171 TCAGGAAAAAGCAGAGCAGTAGG + Intergenic
1010645858 6:78386976-78386998 TTAGGCATGGTTAGAGCAGCTGG + Intergenic
1011918981 6:92547544-92547566 TCAGCCACGGCCGGAGCAGCTGG - Intergenic
1012690781 6:102308316-102308338 TCAGCCATGGCTAGAGCAGCTGG + Intergenic
1013493901 6:110678430-110678452 TGAGGCGAGGGAAGAGCAGTGGG - Intronic
1014406977 6:121064588-121064610 TCAGCCATGGGTAGAGCAGCTGG - Intergenic
1014648687 6:124008095-124008117 TCAGGCCAGGGCAGAGTACATGG + Intronic
1014768466 6:125434308-125434330 TCAGGCATGAGCAGGGCAGGAGG - Intergenic
1016866922 6:148776857-148776879 CCAGGTAAGGGCAGGACAGCGGG - Intronic
1018630407 6:165817143-165817165 ACAGGCAAGCAGAGAGCAGCAGG - Intronic
1018714679 6:166522599-166522621 TCAGGCAATGGCCGCGCAGTGGG - Intronic
1019006290 6:168799471-168799493 TCAGGGAAGGTTAGAGCAGTAGG - Intergenic
1019304095 7:324350-324372 TCAGGAGAGGGCAGAGCTGGGGG - Intergenic
1019605296 7:1907142-1907164 CGTGGCAAGGGCTGAGCAGCTGG - Intronic
1020271007 7:6595882-6595904 ACAGCCAAGGGCAGAGGAGGAGG - Intronic
1020415812 7:7944646-7944668 TCAGGCGCAGGCAGAGCTGCTGG - Intronic
1020707826 7:11567658-11567680 TCAGGTAAGGCCTGAGCTGCAGG + Intronic
1021036861 7:15810078-15810100 TCAGCCAAGGCTGGAGCAGCTGG + Intergenic
1023751654 7:43378840-43378862 TCAGGCAAGGGCAGAGCAGCAGG + Intronic
1023751743 7:43379561-43379583 TCAGGCAAGGGCAGAGCAGCAGG - Intronic
1024047281 7:45593277-45593299 TGAGCCAAGGGCAGAGCTGGTGG - Intronic
1024645663 7:51368487-51368509 TCAGGCGAAGTCAGAGCTGCTGG + Intergenic
1025306703 7:57868080-57868102 TCTGGCAAGGGCAGCGCGGAGGG - Intergenic
1026512026 7:71035347-71035369 TAAGGCAAGGAGATAGCAGCAGG + Intergenic
1026734724 7:72942334-72942356 GCAGGCAAGGGCACAGATGCAGG - Exonic
1026785058 7:73297246-73297268 GCAGGCAAGGGCACAGATGCAGG - Intergenic
1026858671 7:73770729-73770751 TACGGGAGGGGCAGAGCAGCAGG - Intergenic
1027109021 7:75422684-75422706 GCAGGCAAGGGCACAGATGCAGG + Exonic
1027342212 7:77221599-77221621 TCAGGCATGTGCTGAGCACCTGG + Intronic
1027767552 7:82364256-82364278 TCTGGCTAGGGCACTGCAGCTGG + Intronic
1029109134 7:98203327-98203349 GCAGAGAAGCGCAGAGCAGCAGG - Intronic
1029111176 7:98213705-98213727 ACAGGCCAGGGCTGAGCAGGAGG - Intergenic
1029546286 7:101212168-101212190 TGAGGCAAGGGCCAGGCAGCAGG + Intronic
1031323742 7:120365595-120365617 TAAGGTAAGGGCAGAGGTGCTGG + Intronic
1033258609 7:139822938-139822960 TCAGGGAAAGCCAGAGCAGGAGG - Intronic
1034437628 7:151070685-151070707 GTGGGCAAGAGCAGAGCAGCAGG - Intronic
1034871072 7:154684250-154684272 TAAGGCAATGGCAGAGTGGCAGG - Intronic
1034944062 7:155250663-155250685 TCGAACAAGGGGAGAGCAGCTGG - Intergenic
1035202867 7:157278251-157278273 TCAGGGAAGGGCAGAGCCTAGGG + Intergenic
1035282493 7:157786831-157786853 GCAGGCAAGGCCAAAGCCGCTGG - Intronic
1035330392 7:158093117-158093139 TCAGGAAAGGACAGAGGTGCAGG - Intronic
1035330407 7:158093184-158093206 TCAGGAAAGGACAGAGGTGCAGG - Intronic
1035341160 7:158163092-158163114 TCATCCCAGGGCAGAGCAGGGGG + Intronic
1035359286 7:158299769-158299791 TCAGGAAGTGGCAGAGCAGTTGG + Intronic
1036181428 8:6588655-6588677 GCAGGACAGGGGAGAGCAGCGGG - Intronic
1036384505 8:8267117-8267139 ACAGGTCATGGCAGAGCAGCTGG + Intergenic
1037838405 8:22227867-22227889 TCAGGCAGGGGCAGAGAGCCCGG - Intronic
1037913108 8:22756203-22756225 TCAGGCAGGAGCTGAACAGCTGG + Intronic
1037937555 8:22925541-22925563 CCAGGCACCGGCAGAGCACCTGG + Intronic
1038398911 8:27268096-27268118 TCAGGAAAGGCCAGGGGAGCTGG - Intergenic
1038565839 8:28619493-28619515 TCAGTCCAGGGAGGAGCAGCAGG - Intronic
1038581667 8:28753478-28753500 TCAGGCCAGGGCTCACCAGCTGG + Exonic
1038696608 8:29812275-29812297 TGGGGCAAGGGCAGGGCACCAGG - Intergenic
1039657296 8:39423583-39423605 TCAGCCATGGCTAGAGCAGCTGG + Intergenic
1039846304 8:41328151-41328173 CCAGGCCAGGGCGGGGCAGCTGG - Intergenic
1041029020 8:53717299-53717321 TCACGCAGTGGCGGAGCAGCAGG + Intronic
1041192962 8:55372043-55372065 TCAGGCACAGGGAGAGGAGCGGG + Intronic
1042213608 8:66406382-66406404 CCAGGCTTGGGCAGAGAAGCTGG - Intergenic
1042926855 8:73975988-73976010 TGAGCCAAGGACAGAGCGGCGGG + Intronic
1044018246 8:87073326-87073348 TCCGGCAAGGGCACAGAAGTGGG - Intronic
1046430696 8:114123646-114123668 TCAGCAAATGGCAGAGAAGCTGG - Intergenic
1046582932 8:116115177-116115199 TTAGGCAAGAACACAGCAGCTGG - Intergenic
1046733455 8:117750819-117750841 TCAGGCAATAGCAGGGTAGCAGG - Intergenic
1047572117 8:126110391-126110413 TCTGGGAAGGGCAGAGGGGCTGG + Intergenic
1048067357 8:130983979-130984001 TCAGCCAGAGGCAGAGTAGCTGG + Intronic
1048579499 8:135719432-135719454 TCATGAAGAGGCAGAGCAGCAGG + Intergenic
1048956482 8:139541299-139541321 TTAGATAAGGGCAGAGCACCTGG + Intergenic
1048961003 8:139577302-139577324 GCTAGCAAGGACAGAGCAGCAGG - Intergenic
1049190060 8:141282349-141282371 TCAGGCTCGTTCAGAGCAGCTGG - Intronic
1049263233 8:141651143-141651165 AGAAGCAAGGACAGAGCAGCAGG + Intergenic
1049806901 8:144545196-144545218 TCAGGTAAGGGCAGTGGAGAGGG - Intronic
1049888752 9:47544-47566 TCAGTCAAGGTCAGAGCCACAGG + Intergenic
1050012545 9:1199817-1199839 TCAGGAGAGAGCAGAGGAGCTGG + Intergenic
1050353682 9:4763400-4763422 TCAGGCCAGGCCAGAGCTGGAGG + Intergenic
1051450693 9:17194022-17194044 TCAGTCATGGCCAGAGCAGCTGG + Intronic
1051530895 9:18101784-18101806 TCAGAAAAAGGAAGAGCAGCTGG + Intergenic
1051678321 9:19580936-19580958 CCAGGGAAGGGCTGAGCTGCAGG + Intronic
1051944224 9:22547012-22547034 TCAGGCAATGGCAGAGAAAAGGG + Intergenic
1053787540 9:41663491-41663513 TCAGGTTAGGGCAGAGGTGCGGG - Intergenic
1054157582 9:61651276-61651298 TCAGGTTAGGGCAGAGGTGCGGG + Intergenic
1054175819 9:61874828-61874850 TCAGGTTAGGGCAGAGGTGCGGG - Intergenic
1054450563 9:65401627-65401649 CCAGGCCGGTGCAGAGCAGCAGG + Intergenic
1054477356 9:65582281-65582303 TCAGGTTAGGGCAGAGGTGCGGG + Intergenic
1054661720 9:67705980-67706002 TCAGGTTAGGGCAGAGGTGCGGG + Intergenic
1056981093 9:91312968-91312990 TGAGGCAATGGCAGAACAGTGGG + Intronic
1058133408 9:101278814-101278836 TCTGGACAGGCCAGAGCAGCAGG + Intronic
1060035007 9:120247692-120247714 TCAGGGAAGGTCAGAGCAGGAGG - Intergenic
1061239060 9:129358693-129358715 GCAGGGGAGGGAAGAGCAGCGGG - Intergenic
1061477809 9:130880688-130880710 GCAGGGAAGGGAAGAGCAGTGGG - Intronic
1061675442 9:132212985-132213007 TCAGGCCTGGGCATAGCAGATGG + Intronic
1061699810 9:132407336-132407358 TGGGACAAGGCCAGAGCAGCTGG + Intergenic
1062468111 9:136690419-136690441 ACTGGCAGGGGCAGGGCAGCCGG + Intergenic
1062721778 9:138048299-138048321 GCAGGCAAGCTCAGAGCAGCAGG - Intronic
1185711264 X:2305214-2305236 TCAGGGAGGGGGAGAGCATCAGG + Intronic
1185750680 X:2608347-2608369 ACAGGCAAGGCCAGAGGGGCTGG - Intergenic
1186360267 X:8833793-8833815 TCAGGGAAGGGGAGAGGAGCAGG - Intergenic
1187428087 X:19196768-19196790 TCAGGCAAGACCAGGGCTGCAGG - Intergenic
1187605141 X:20874642-20874664 TCAGGGAAGCACTGAGCAGCAGG + Intergenic
1189597713 X:42587354-42587376 TGAGGCCAGGCCATAGCAGCGGG + Intergenic
1190108118 X:47573422-47573444 TCAGCCTAAGGCAGAGCAGCTGG + Intronic
1192706925 X:73536198-73536220 ACAGGAAAGAGCAGAGCAACAGG + Intergenic
1193149873 X:78113826-78113848 TCAGGCATGGGCACACCATCAGG - Exonic
1193204664 X:78734688-78734710 ACAGGAAAGGAGAGAGCAGCAGG - Intergenic
1193374822 X:80746848-80746870 TCAGGCAAAGGCAGATCCACTGG + Intronic
1193438969 X:81515496-81515518 TCAGCCAAGGCTGGAGCAGCTGG - Intergenic
1193482415 X:82044074-82044096 TCAGGCATGGCTGGAGCAGCTGG - Intergenic
1193539730 X:82756610-82756632 TAGGGGAAGGACAGAGCAGCAGG + Intergenic
1194662095 X:96639052-96639074 TCAGCCATGGCTAGAGCAGCAGG - Intergenic
1195702282 X:107714605-107714627 CCTGGCAAGCCCAGAGCAGCTGG - Exonic
1199002100 X:142651083-142651105 TCAGGCATTGGCAGAGCGTCAGG - Intergenic
1199621523 X:149705753-149705775 CCAGGGTAGGGCAGAGCAGATGG - Intronic
1200045374 X:153398089-153398111 GCAGGTGAGGGAAGAGCAGCAGG - Intergenic
1200985300 Y:9297046-9297068 GCAGGCACAGACAGAGCAGCTGG - Intergenic
1201226877 Y:11827034-11827056 TCAGGCAAGGGGAGAGCCATGGG + Intergenic