ID: 1023752383

View in Genome Browser
Species Human (GRCh38)
Location 7:43385132-43385154
Sequence CCGATTGGAAGAGGGTGTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 110}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023752383_1023752389 7 Left 1023752383 7:43385132-43385154 CCTCAACACCCTCTTCCAATCGG 0: 1
1: 0
2: 0
3: 6
4: 110
Right 1023752389 7:43385162-43385184 GTTCTATCCATTTTATCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023752383 Original CRISPR CCGATTGGAAGAGGGTGTTG AGG (reversed) Intronic
904058699 1:27689345-27689367 CAGAATGGAAGAGCATGTTGAGG - Intergenic
908015480 1:59828813-59828835 CCGAATTAAAGAGGATGTTGGGG + Exonic
908536485 1:65083224-65083246 AGGATTGCAAGAGGTTGTTGGGG + Intergenic
908849383 1:68359437-68359459 CAGAGTGGAAGATGGAGTTGTGG - Intergenic
910593807 1:88956613-88956635 AAGAATAGAAGAGGGTGTTGAGG + Intronic
912693452 1:111821825-111821847 CTGTTTGGAAGTGGGTGGTGGGG + Intronic
913593847 1:120354680-120354702 CCGAGTGGCAGAGGGTGGGGCGG + Intergenic
914093408 1:144524306-144524328 CCGAGTGGCAGAGGGTGGGGCGG - Intergenic
914305120 1:146409596-146409618 CCGAGTGGCAGAGGGTGGGGCGG + Intergenic
914596938 1:149163229-149163251 CCGAGTGGCAGAGGGTGGGGCGG - Intergenic
914846540 1:151286827-151286849 CCGAGTGGGAGAGGGTGCAGAGG - Exonic
915230344 1:154441267-154441289 TCTATTGGAAGATGGTGTGGTGG + Intronic
918332525 1:183472981-183473003 CCGAGTGGAGGTGGGTGTGGAGG + Intronic
1065555576 10:26912320-26912342 CAGATTGGAAGAGGGCAATGAGG + Intergenic
1067220543 10:44341054-44341076 CAACTTGGAAGAGGGTGTAGAGG - Intergenic
1073797054 10:107000091-107000113 CTGATGGGGAGAGGGTGATGTGG - Intronic
1074267490 10:111918967-111918989 CCAACAGGAAGAGGGTGTAGGGG + Intergenic
1074325590 10:112447481-112447503 CCGGCTGGACGAGGGTGCTGGGG + Intronic
1074824525 10:117204995-117205017 ACAACTGGAAGAGGATGTTGGGG + Intronic
1075099725 10:119497664-119497686 CCCTTTGGAAGAGCCTGTTGTGG - Intergenic
1075800254 10:125149345-125149367 CCACCTGGAAGAGGGTGGTGGGG - Intronic
1078402787 11:11043017-11043039 CCCTTTGGATGAGGGTGTTTGGG + Intergenic
1086996313 11:93360182-93360204 CTGATTGGAAGTGGGAGTTCAGG - Intronic
1091092410 11:132784387-132784409 CAGATTGGAAGTTGGTGCTGTGG - Intronic
1092927009 12:13280438-13280460 GAGGTGGGAAGAGGGTGTTGAGG - Intergenic
1094426468 12:30321640-30321662 CCAATGGGAAGAGGATGGTGTGG - Intergenic
1095268155 12:40184081-40184103 ACAATTGGAAGATGGTGTGGGGG - Intergenic
1101680250 12:106956704-106956726 CTGATTGGAAGTGGGAGCTGGGG - Intronic
1101819858 12:108175387-108175409 CAGGTTGGAAGAGGGTGGTGCGG - Intronic
1102463610 12:113115238-113115260 TAGAACGGAAGAGGGTGTTGGGG + Exonic
1102494541 12:113310395-113310417 TCCATTGTAAGTGGGTGTTGAGG - Intronic
1102719435 12:115003432-115003454 CCGAATGGATGAGGGTCTTCTGG - Intergenic
1105523469 13:21152697-21152719 AGGAGTGGAAGAGGGTGGTGTGG + Intergenic
1115201061 14:30854610-30854632 CAGATTGGATGTGGGTGTTGAGG - Intergenic
1118887780 14:69880569-69880591 CCAATTGGTGGGGGGTGTTGCGG - Intronic
1124973976 15:34516479-34516501 CTGGTTGAAAGAGGGTGCTGGGG + Intergenic
1126538512 15:49795568-49795590 CGGAGTGGAAGAGGGGGTTCTGG + Intergenic
1127292427 15:57582308-57582330 CCCATTAGAGGAGGGTGATGGGG + Intergenic
1132186287 15:99804600-99804622 CTGGTTGAAAGAGGGGGTTGGGG - Intergenic
1132429389 15:101748106-101748128 CTGGTTGAAAGAGGGGGTTGGGG + Intergenic
1133712812 16:8417794-8417816 CCTAGGGGAAGAGGGTGTTGGGG - Intergenic
1137264465 16:46857495-46857517 GAGATGGGAGGAGGGTGTTGAGG + Intergenic
1138270505 16:55692508-55692530 GTGGTTGGATGAGGGTGTTGGGG - Intronic
1139198812 16:64951326-64951348 CCGGGTGGCTGAGGGTGTTGGGG - Intronic
1142269804 16:89083619-89083641 CCGGGGGGAAGAGGCTGTTGCGG - Intergenic
1142269818 16:89083652-89083674 CCGGGGGGAAGAGGCTGTTGCGG - Intergenic
1142269884 16:89083816-89083838 CCGGGGGGAAGAGGCTGTTGCGG - Intergenic
1142269898 16:89083849-89083871 CCGGGGGGAAGAGGCTGTTGCGG - Intergenic
1142269912 16:89083882-89083904 CCGGGGGGAAGAGGCTGTTGCGG - Intergenic
1142270003 16:89084110-89084132 CCGGGGGGAAGAGGCTGTTGCGG - Intergenic
1142270017 16:89084143-89084165 CCGGGGGGAAGAGGCTGTTGCGG - Intergenic
1142284856 16:89167557-89167579 CCGATTGCTGGAGGGTGTTCAGG - Intergenic
1143455209 17:7063063-7063085 CTGATTGGGAGAGGATGATGTGG - Intergenic
1144657200 17:17044060-17044082 CCGACTGGAGTAGGGTGGTGGGG + Intronic
1144801390 17:17930529-17930551 CTGATTGCAAGAGGCTGCTGGGG - Intronic
1149298704 17:55284778-55284800 CCAATTTGAACAGGGTGTTGGGG - Intronic
1150339617 17:64356025-64356047 CCCCTTGTAAGAGGGAGTTGGGG - Intronic
1150444116 17:65215252-65215274 CCGATTGAAATGGGGTGATGTGG + Intronic
1151494808 17:74453047-74453069 ACGATTGGAAGAGGATGCTAAGG + Intergenic
1154057666 18:11026737-11026759 CAGTTTTGAAGAGGGTGCTGAGG - Intronic
1156012085 18:32507531-32507553 CAGACTGGAAAAGAGTGTTGAGG + Intergenic
1163898213 19:20078185-20078207 CCGATGGGAAGTGGCTGTGGCGG + Intronic
1164136559 19:22422121-22422143 CCGGTGGGAAGAGGCTGTGGCGG - Intronic
1166295565 19:41887757-41887779 CCTAATGGAAGAGGGGGCTGGGG - Intronic
925740609 2:7002526-7002548 GCGAAGGAAAGAGGGTGTTGGGG + Intronic
926690438 2:15729552-15729574 CAGATTGGCAGGGGGTGATGGGG + Intronic
930059486 2:47276594-47276616 GAGGTTGGAAGAGGGGGTTGGGG - Intergenic
932278164 2:70467035-70467057 CCTTTTGGGGGAGGGTGTTGGGG + Intronic
933368989 2:81391216-81391238 CAGATTGGAGGAAGGTGTAGGGG - Intergenic
942867131 2:180690408-180690430 ATGGTTGGAAGAGGGTATTGGGG + Intergenic
947603394 2:231468284-231468306 CCTGCTGGAGGAGGGTGTTGTGG + Intronic
1168997959 20:2146715-2146737 CCCTCAGGAAGAGGGTGTTGGGG - Exonic
1170932192 20:20779150-20779172 CCTCTTGGAAGAGGGTCTTATGG - Intergenic
1172082952 20:32357373-32357395 CAGATTGGAAGAGGATGTGAAGG - Intergenic
1173568944 20:44064660-44064682 ACGAATGGACGAGGGTGGTGGGG - Intronic
1176262414 20:64189048-64189070 CAGATAAGAAGAGGGTGCTGTGG + Intronic
1178701144 21:34834857-34834879 CCCATTGGAAGTGGGTGTAGAGG - Intronic
1178745462 21:35245541-35245563 GAGATTGGAAGAGGCTGTGGAGG - Intronic
1183293293 22:37015841-37015863 CCTCTTGGAGGAGGGGGTTGGGG + Intronic
1183396994 22:37577219-37577241 CCGAGAGGCAGAGGGTGATGAGG + Intronic
951490021 3:23259721-23259743 CGTATTGGAAGAGGTTGATGGGG + Intronic
957168542 3:76707806-76707828 CAGATTGGAGGAGGGTGGTCTGG - Intronic
962267380 3:133953589-133953611 CTGATTGGATGAGGGGGCTGGGG + Intronic
969414360 4:7049014-7049036 CCGCTATGAAGATGGTGTTGAGG + Intronic
970244010 4:14039722-14039744 ACAATTGGAAGTGGGGGTTGGGG + Intergenic
975402753 4:73956540-73956562 CCTATTGGAAGATGGAGTTAGGG - Intergenic
977018019 4:91718520-91718542 ACAATTGGAAGGGGGTGTCGAGG + Intergenic
978016037 4:103748066-103748088 CCCATTGGAAGAGGTTATTATGG + Intergenic
978429103 4:108614827-108614849 CATATTGGAGGAGGGTGATGGGG - Intergenic
978652707 4:111026640-111026662 CAGATGGGATGAGGGTGTAGAGG - Intergenic
979074015 4:116247881-116247903 ACCATTGGAAGAGGGTAGTGAGG - Intergenic
995403481 5:111767586-111767608 ACAAGTGGAAGAGGGAGTTGAGG - Intronic
997626480 5:135334609-135334631 CCGTTTGTAAGCGTGTGTTGTGG - Exonic
1005748621 6:28863165-28863187 GCGATGGGAAGAGAGTGGTGGGG + Intergenic
1007637614 6:43308601-43308623 CCGAGTGGGAGCGGGTGGTGCGG + Intronic
1008606974 6:53150051-53150073 AGGACTGGAAGAGGGTGTTTCGG + Intergenic
1014097132 6:117472673-117472695 CAGAGTGGAAGAGTGTGTTTCGG - Intronic
1018081924 6:160266566-160266588 CAGAGTGGAAGAGCGTGTTTGGG + Intronic
1020367809 7:7399225-7399247 CAGACTGGATGAGGGTGTTCAGG - Intronic
1022230898 7:28410862-28410884 GCGATTGCACGAGTGTGTTGTGG - Intronic
1023410177 7:39882391-39882413 CCGAGTGGGATAGGGTGTAGGGG + Intergenic
1023752383 7:43385132-43385154 CCGATTGGAAGAGGGTGTTGAGG - Intronic
1024932075 7:54674690-54674712 CCTATTGGAGGAGAGAGTTGTGG + Intergenic
1025865125 7:65374052-65374074 CCGATTGGAAGTGGCTGTGGCGG + Intronic
1030127479 7:106168313-106168335 CTGTGTGGAAGAGGGTGTAGGGG + Intergenic
1033156765 7:138963439-138963461 ACAATTGGAAGAGGGAGTAGAGG + Intronic
1041378007 8:57221909-57221931 ACAGTTGGAAGAGGGTGTAGTGG + Intergenic
1045986190 8:108252104-108252126 CCGATAGGAAGTGGTTGTTTAGG - Intronic
1045997986 8:108385683-108385705 CAGATTGGAAGATAGAGTTGAGG + Intronic
1056709388 9:88978303-88978325 CTTGTTGGAAGAGGGTGTCGAGG + Intergenic
1058948710 9:109883133-109883155 ACCATTGGAAGGAGGTGTTGTGG + Intronic
1060176264 9:121499562-121499584 GCGCTTGGGAGAGGGTGGTGAGG - Intergenic
1186200022 X:7147798-7147820 CCGACCGGAAGCGGGTGCTGGGG + Intronic
1188013566 X:25083428-25083450 TCCATTAGAAGAGGGTCTTGGGG + Intergenic
1194066846 X:89271391-89271413 CCGGTTGCAACAGGGTGTGGGGG + Intergenic
1198048509 X:132926469-132926491 AGGATTGGAAGAGGCTGTTCTGG - Intronic
1200721011 Y:6605550-6605572 CCGGTTGTAACAGGGTGTAGGGG + Intergenic