ID: 1023754195

View in Genome Browser
Species Human (GRCh38)
Location 7:43400826-43400848
Sequence CTAAAATCAAGCTGTCAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3498
Summary {0: 1, 1: 9, 2: 200, 3: 879, 4: 2409}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023754194_1023754195 -3 Left 1023754194 7:43400806-43400828 CCAGAATGAATGTTAAGGGACTA 0: 1
1: 0
2: 0
3: 13
4: 101
Right 1023754195 7:43400826-43400848 CTAAAATCAAGCTGTCAGCCAGG 0: 1
1: 9
2: 200
3: 879
4: 2409

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023754195 Original CRISPR CTAAAATCAAGCTGTCAGCC AGG Intronic
Too many off-targets to display for this crispr