ID: 1023754335

View in Genome Browser
Species Human (GRCh38)
Location 7:43402064-43402086
Sequence GTGGTGAGCTGGAAAGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1085
Summary {0: 1, 1: 0, 2: 23, 3: 207, 4: 854}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023754335 Original CRISPR GTGGTGAGCTGGAAAGAGGA TGG (reversed) Intronic
900504947 1:3025175-3025197 GTGTTGAGCTGGAGTAAGGAAGG + Intergenic
900741175 1:4332226-4332248 CTGGGGAGCTGGGAAGGGGATGG + Intergenic
900741844 1:4335060-4335082 GTAGTGAGGTGGAAAGAGCATGG + Intergenic
901511375 1:9719684-9719706 GGGGTGAGGTGGGAACAGGAGGG + Intronic
902373600 1:16019751-16019773 GAGGTGAGATGGAGAGAGGGTGG + Intronic
902749738 1:18499451-18499473 ATGGGGACCTGGAAAGGGGAAGG - Intergenic
903233376 1:21935248-21935270 GTGGTGGGCTGGAAAGAGCTTGG - Intronic
903827285 1:26155411-26155433 GTGGGAAGCTTCAAAGAGGAGGG - Intergenic
903872452 1:26446256-26446278 CTGCTGAGCTGGAGAGAGCAAGG - Intronic
904012160 1:27395916-27395938 CTGGGGAGCTGGACAGAGGGTGG + Intergenic
904295708 1:29518484-29518506 GTGGTGTGCTGGAAGGAGCTTGG + Intergenic
904526306 1:31136395-31136417 ATGGGGAGCAGGAAAGGGGATGG - Intergenic
905562907 1:38941577-38941599 GTGCTGTGCAGGAAGGAGGAGGG - Intronic
905830193 1:41059500-41059522 ATGGGGAGCTGGAAAGGGGATGG - Intronic
906129132 1:43445603-43445625 GTGCTGGGCAGGAAAGAGAAGGG - Intronic
906138775 1:43520648-43520670 GTGGGGAGCTGGATGGGGGAGGG + Intergenic
906249276 1:44298997-44299019 GTGGTTAGCTGGCAAGGGGAAGG + Intronic
906304318 1:44706926-44706948 GAGGTGAGGTGGGGAGAGGAAGG - Intronic
906485811 1:46234007-46234029 GAGGAGAACTGGAAAGATGATGG - Intergenic
906860497 1:49353882-49353904 TTGGGGAGCTGGAAAGAGGATGG - Intronic
906901902 1:49844610-49844632 GTGGTGAGATGGGAAGAGGAAGG - Intronic
907425364 1:54375946-54375968 GAGGAGAGCAGGGAAGAGGAAGG + Intronic
908059616 1:60333459-60333481 GTGGGGAGCTAGAAAGGGGCTGG - Intergenic
908644909 1:66266698-66266720 GTTGAGAGCTGCAGAGAGGAAGG + Intronic
908896777 1:68909963-68909985 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
909086447 1:71174281-71174303 GTGGGGAGCTGGAAGGAGGATGG + Intergenic
909094504 1:71270832-71270854 ATGGAGAGCTGGAAAGGGGATGG + Intergenic
909917405 1:81337113-81337135 ATGGAGAGCTGGAAAGGGGATGG - Intronic
910149623 1:84126342-84126364 ATGGGGAGCTGGAAAGCGGATGG + Intronic
910150250 1:84134027-84134049 AAAGGGAGCTGGAAAGAGGATGG + Intronic
910266136 1:85339836-85339858 CAGTTGAGCTGGAAGGAGGAGGG - Intronic
910354824 1:86342178-86342200 GTGGGGAGCAGAAAAGTGGAGGG - Intergenic
910630009 1:89344631-89344653 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
910653772 1:89599431-89599453 GTGGAGAGCTGGACAGAAGTGGG - Intergenic
910748722 1:90603416-90603438 GTGAAGGGCTGGAAAGAGGATGG + Intergenic
911335439 1:96575177-96575199 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
912041738 1:105398696-105398718 GTGGGGAATTGGAAAGGGGATGG + Intergenic
912462801 1:109847801-109847823 GTCTTGAGTTGGAAAGAGGGAGG + Intergenic
912469512 1:109896744-109896766 GTGGAGAGCGGGAAAGAGAGGGG + Intergenic
912522489 1:110255334-110255356 GGGGTGAGCTGGAGAGAAGACGG - Intronic
912812012 1:112802027-112802049 GGGGTGGGCTGGGAAGAGGAGGG - Intergenic
912812296 1:112803420-112803442 GTGGTGAGAGTGAAAGGGGATGG - Intergenic
912903219 1:113675175-113675197 GTGGTGTGCAGGAAGGATGAAGG + Intronic
913097675 1:115534848-115534870 AGGGGGAGCTGGAAAGGGGATGG - Intergenic
914000365 1:143689559-143689581 ATGGGGAACTGGAGAGAGGAAGG + Intergenic
915429746 1:155857116-155857138 GTGGTGGGGTGGGAAGAGGCAGG - Intronic
916053634 1:161052775-161052797 GTGGTGAGGTGGAGAGTGGGTGG - Exonic
916384255 1:164249739-164249761 ATGGGGAGCTGGAAAGGGGCTGG - Intergenic
916705166 1:167341871-167341893 ATGGGGAGCTGGAAAGGGAATGG + Intronic
916764736 1:167849399-167849421 TAGGTGAGGTGGAAATAGGAAGG + Intronic
916951576 1:169785489-169785511 ATGGGGAGCTGGAAGGGGGATGG + Intronic
917087576 1:171319196-171319218 CTGGGGAGCTGGAAAGGGGATGG + Intronic
917211022 1:172632100-172632122 ATGGGGAACTGGAAAGGGGATGG - Intergenic
917588922 1:176457337-176457359 ATAGGGAGCTGGAAAGGGGATGG + Intergenic
917589195 1:176459637-176459659 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
918102143 1:181385743-181385765 GAGGAGAGGAGGAAAGAGGAAGG - Intergenic
918125612 1:181580790-181580812 GTGGGGACCTGGAAGGAGGAGGG + Intronic
918188141 1:182145593-182145615 GTGGGGAGACAGAAAGAGGAAGG + Intergenic
918227293 1:182495642-182495664 GTGGTGATCCTGAAAGATGATGG - Intronic
918343831 1:183589463-183589485 GTGGTAAGGTGGAAAGGGTATGG - Intronic
918990501 1:191692713-191692735 GAGGGGAGCTGGAAGGGGGATGG - Intergenic
919162793 1:193853386-193853408 GAGGGGAGCAGGAAAGAGGATGG - Intergenic
919240847 1:194914361-194914383 AAGGAGAGCTGGAAAGGGGAAGG - Intergenic
919656317 1:200200719-200200741 ATGGGGAGCTGGAAAGGAGATGG - Intergenic
920044406 1:203124250-203124272 GAAGTGAGCTGGAAGGAGGGAGG + Intronic
920839548 1:209542730-209542752 GTGGTGGGAGGGAGAGAGGAGGG - Intergenic
920874671 1:209822953-209822975 GTGGGGAACTGCACAGAGGATGG - Intergenic
921022686 1:211250720-211250742 GAGGCAAGATGGAAAGAGGATGG - Intergenic
921077659 1:211712708-211712730 GCGGTGAGGTGGGGAGAGGAGGG - Intergenic
921199733 1:212793076-212793098 CTGATGAGCTAGAAAGAGAAAGG + Intronic
921632884 1:217456015-217456037 ATGGGGAGCTGGGAAGGGGACGG - Intronic
921837812 1:219795716-219795738 GTGGTGAACTGGAGATAGGGTGG - Intronic
921985140 1:221304668-221304690 GCACTGAGCTGGAAGGAGGAGGG - Intergenic
922223858 1:223628449-223628471 TAGGGGAGCTGGGAAGAGGATGG + Intronic
922334298 1:224606376-224606398 ATGGGGAGCTGGAAAGGGGATGG + Intronic
922729495 1:227942345-227942367 GTGCAGAGCAGGAAGGAGGAAGG + Intronic
922913831 1:229239558-229239580 GAGGGGAGCTGGAAAAGGGATGG + Intergenic
923006708 1:230055734-230055756 GCAGTGAGCTGGAAAGACAATGG - Intergenic
923094230 1:230761840-230761862 GTGGTCTGCTGGGAACAGGAAGG - Intronic
923196313 1:231671532-231671554 GTGTTGAGCTGGGGAGAAGAAGG - Intronic
923566137 1:235077281-235077303 AAGGAGGGCTGGAAAGAGGAAGG + Intergenic
923911103 1:238444912-238444934 GAGGGGAGCTGGAAAAGGGATGG - Intergenic
923927983 1:238657902-238657924 GTGGATAGGAGGAAAGAGGAGGG + Intergenic
923972056 1:239215312-239215334 GTAATGTGTTGGAAAGAGGAAGG - Intergenic
923975481 1:239257319-239257341 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
924286553 1:242493607-242493629 GAGGATAGCTGGAGAGAGGACGG + Intronic
924438115 1:244063530-244063552 TTGGTGAGCTGGAAGGAGATGGG - Intergenic
924679669 1:246219426-246219448 AAGGTGAGCTGAAAAGGGGATGG - Intronic
1063131887 10:3185459-3185481 ATGGGGAGCTGGAAAGGGAATGG - Intergenic
1063682981 10:8208252-8208274 GAGAAGAGCTGGAAAGAGGCAGG + Intergenic
1063906430 10:10784493-10784515 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1063936302 10:11082105-11082127 GTGGAGGGCAGGAATGAGGAAGG + Intronic
1064599347 10:16977514-16977536 ATGGGGAGCTGGAAAGGGGGTGG - Intronic
1064600178 10:16985398-16985420 ATGGGGAACTGGAAAGGGGATGG - Intronic
1064785268 10:18887986-18888008 ATGGAGAGCTGGGAAGGGGATGG - Intergenic
1065009138 10:21405964-21405986 ATGGGGAGTTGGAAAGGGGATGG - Intergenic
1065428161 10:25627345-25627367 AGGGTGGGGTGGAAAGAGGATGG - Intergenic
1065454402 10:25891951-25891973 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1065808238 10:29415490-29415512 GTGGTGGCGTGGTAAGAGGAAGG - Intergenic
1066196647 10:33106699-33106721 GAGGGGAGCTGGAAAGATGATGG - Intergenic
1066251471 10:33637281-33637303 ATGGGGAGTTGGAAAGGGGATGG - Intergenic
1066281014 10:33918446-33918468 ATGGAGAGCTGGAAAGGGAATGG + Intergenic
1066305115 10:34133016-34133038 ATGGGAAGCTGGAAAGGGGATGG - Intronic
1066428196 10:35328241-35328263 GTACTGGGCTGGAAAGAGGCAGG - Intronic
1067120944 10:43471626-43471648 GAGGGGAACTGGAAAGGGGACGG + Intronic
1067266292 10:44748278-44748300 GAGGGGAGCTGGAAAGGGGATGG + Intergenic
1067828706 10:49597698-49597720 GATGTCAGCTGGAAAGAAGAGGG - Intergenic
1067897627 10:50201161-50201183 ATGGGGAGCTGGAAAGGGGATGG - Intronic
1067922378 10:50472911-50472933 GTGGGGAGCAGGATAGAGGAAGG - Intronic
1068318848 10:55383134-55383156 AAGGGGAGCTGGAAAGGGGATGG + Intronic
1068358577 10:55945113-55945135 GTGGAGAGCTGGAAAGGGGATGG + Intergenic
1068497902 10:57808387-57808409 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1068885099 10:62089842-62089864 GGGATGAGATGGAAAAAGGAGGG + Intronic
1069601061 10:69708449-69708471 ACGGGGAGCTGGAAAGGGGATGG - Intergenic
1069623878 10:69854970-69854992 GTGCTGGTGTGGAAAGAGGATGG + Intronic
1070204469 10:74242892-74242914 GAGGGGAGCTGGAGAGGGGACGG - Intronic
1070346104 10:75543471-75543493 GTGGGGAGGAGGAGAGAGGAAGG + Intronic
1070917660 10:80165199-80165221 GTGGTGGCCTGGAAAGGAGAGGG - Intronic
1071149774 10:82620403-82620425 GAGGGGAGCTGGAGAGGGGATGG + Intronic
1071237329 10:83664296-83664318 GTGCTGAGCTGCAAGGAAGAAGG - Intergenic
1071490121 10:86130629-86130651 ATGGGGAGCTGGAAAGGGGTTGG - Intronic
1071960383 10:90804196-90804218 AAGGGGAGCTGGAAAGGGGATGG - Intronic
1072009709 10:91292300-91292322 GTGGGGAGCTTGAGAAAGGAAGG - Intergenic
1072443803 10:95480472-95480494 GTGGTGTGGTGGAAAGAGCATGG + Intronic
1072875030 10:99163417-99163439 CTGAGGAGGTGGAAAGAGGAAGG - Intronic
1072972031 10:100025696-100025718 ATGTGGAGCTGGAAAGGGGATGG + Intergenic
1073385600 10:103125418-103125440 GTGGTGGCGTGGAAAGATGATGG + Intronic
1073618184 10:105019475-105019497 GAGAAGAGATGGAAAGAGGAAGG - Intronic
1073735076 10:106336273-106336295 ATGGTGAGCTGGAAAGGGGATGG - Intergenic
1073911219 10:108347047-108347069 GAGGGGAGAGGGAAAGAGGAGGG + Intergenic
1074082597 10:110179543-110179565 TTGGTGAGCTGCAACGAGGATGG + Intergenic
1074162656 10:110846893-110846915 ATGTGGAGCTGGAAGGAGGAAGG - Intergenic
1074477232 10:113784399-113784421 GTGCTGGGCTGGGAAGAGCATGG - Intergenic
1074710049 10:116169681-116169703 ATGTGGAGCTGGAAAGGGGATGG - Intronic
1075848671 10:125568069-125568091 ATGGGGAGCTGGAAAGGAGATGG - Intergenic
1076053382 10:127352320-127352342 GTGGGGAGGGGCAAAGAGGATGG + Intronic
1076102512 10:127794398-127794420 ATGGGGAGCTGGAAAGGGAATGG - Intergenic
1077087342 11:760546-760568 GTGTTGATCAGGACAGAGGAAGG - Intronic
1077493311 11:2872124-2872146 GGGGTGAGCAGGAAGGAAGATGG - Intergenic
1077712440 11:4550836-4550858 GTGGGGAGCTGGAAAGGGGATGG - Intergenic
1077712978 11:4554366-4554388 GTGGGGAGCCGGAAAGGGGATGG - Intergenic
1078050896 11:7963836-7963858 GTGTTGAGAGGGAAAGAGGAAGG - Intronic
1078327666 11:10393742-10393764 GTCCTGAGCATGAAAGAGGAGGG + Intronic
1079538080 11:21539519-21539541 ATGCGGAGCTGGAAAGGGGATGG + Intronic
1079660910 11:23035552-23035574 AAGGGGAGGTGGAAAGAGGATGG - Intergenic
1080302908 11:30804361-30804383 GTGGTGCCCTGGAAAGAGCATGG + Intergenic
1080604410 11:33852892-33852914 GAGGGGAGCTGGAGAGGGGACGG + Intergenic
1080723830 11:34875094-34875116 ATGGGGAGCTGGAAAGAGGATGG - Intronic
1080822006 11:35816316-35816338 GAGCTGAGTTGGGAAGAGGATGG - Exonic
1081312812 11:41593994-41594016 ATGGGGAGCTGGGAAGAGGATGG + Intergenic
1081374211 11:42339858-42339880 ATAGGGAGCTGGAAAGGGGATGG - Intergenic
1081872032 11:46387591-46387613 GGGGTGAGGTGGTGAGAGGAAGG + Intergenic
1081912816 11:46711011-46711033 GTGGTGATCTGTGAAGAGAAAGG + Intergenic
1082645542 11:55720104-55720126 GGGAGGAGCTGGAAAGGGGATGG + Intergenic
1083134872 11:60662843-60662865 GTGGGGAGATGGAAAAAGAAGGG - Intergenic
1083169273 11:60913219-60913241 AAGGTGAGCTGAAAAGAGGGGGG + Intergenic
1083823701 11:65186626-65186648 CTGGTGAACTGGACAGAGGATGG - Intronic
1084183405 11:67457692-67457714 GTGGTGAGGTGGGCAGAGGGGGG + Intronic
1084561906 11:69910160-69910182 GTGGGGAGTGGGCAAGAGGAGGG - Intergenic
1084766493 11:71312379-71312401 AAGGTGAGCTGGAAAGGGGATGG + Intergenic
1084803590 11:71564010-71564032 AAAGTGAGCTAGAAAGAGGAGGG + Intronic
1084972911 11:72781366-72781388 GTGGGGAGCTGGAGAGAGGTAGG + Intronic
1085348015 11:75780633-75780655 GTGGGGAGCTGGAAGGGGAAGGG - Intronic
1085836886 11:79966562-79966584 GTGGTGAGCAGGATAGGGAAAGG + Intergenic
1085947009 11:81284459-81284481 ATGGGAAGCTGGAAAGGGGATGG - Intergenic
1086286395 11:85256342-85256364 ATGGGGAGCTGGAAAGCAGATGG - Intronic
1087390766 11:97530268-97530290 GTGGGGAGCTGAGAACAGGAAGG + Intergenic
1087467400 11:98525993-98526015 ATCGTGAGCTGGAAAGGGGATGG + Intergenic
1087580376 11:100043698-100043720 GAGGTGAGCTTGAAGGATGAAGG - Intronic
1087602979 11:100339357-100339379 GAAGGGAGCTGGAAAGGGGATGG + Intronic
1087677090 11:101175682-101175704 GTGGGGAGCCAGAAAGGGGATGG - Intergenic
1087698784 11:101412399-101412421 ATGGCGAGCTGGAAAGGGGATGG - Intergenic
1088347962 11:108851221-108851243 GGGGTGGGGTGGAAAGAGAAGGG + Intronic
1088396911 11:109379130-109379152 CAGGTAAGCTGGACAGAGGATGG + Intergenic
1088428337 11:109729693-109729715 AAGGGGAGCTGGAAAGGGGATGG - Intergenic
1088450618 11:109977747-109977769 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1088517137 11:110649565-110649587 GCGGTGAGCTGGGAAGAAGTGGG + Intronic
1088777594 11:113100548-113100570 ATGGAGAGCTGGAAAGGGGATGG + Intronic
1088972701 11:114787605-114787627 CTGGGGAGTTGGAGAGAGGAGGG + Intergenic
1088999363 11:115038198-115038220 CTGGGCAACTGGAAAGAGGAAGG - Intergenic
1089625576 11:119748814-119748836 GTGGTGAGAAGGACAGAGAAGGG + Intergenic
1089833234 11:121347589-121347611 GTGGTGTTCTGATAAGAGGAGGG + Intergenic
1090554123 11:127855597-127855619 ATGGGGAGCTAGAAAGAGGATGG + Intergenic
1090678912 11:129031994-129032016 ATGGGGAGCTGGAAAGGGGATGG - Intronic
1091232306 11:133996633-133996655 GTGGTGTGGTGGAAAGACGAGGG - Intergenic
1091379404 12:46262-46284 CAGGAGAGCTGGACAGAGGAAGG - Intergenic
1091663166 12:2399442-2399464 ATGGGGAGCTTGAAAGGGGATGG + Intronic
1091812891 12:3414720-3414742 ATGGGGAGTTGGAAAGGGGATGG + Intronic
1092167952 12:6354625-6354647 GGGGGGTGGTGGAAAGAGGATGG - Intronic
1092218129 12:6696423-6696445 CTGGTAAGCTGGGAGGAGGAAGG - Exonic
1092569083 12:9702239-9702261 ATAGGGAGCTGGAAAGTGGATGG + Intergenic
1092836244 12:12491823-12491845 TGAGTGAGCTGGAAAGTGGAAGG - Intronic
1093369695 12:18352721-18352743 ATGGAGAGCTAGAAAGGGGATGG + Intronic
1093369912 12:18354340-18354362 GGGGCAAGCTGGAGAGAGGACGG + Intronic
1093370311 12:18356668-18356690 ATGGAGAGCTGGAAAGGAGATGG + Intronic
1093517400 12:20004816-20004838 GTGATGTGCTTGACAGAGGACGG - Intergenic
1093592333 12:20917666-20917688 GAGGGGAGCTGGAGAGGGGATGG + Intergenic
1093731234 12:22568043-22568065 GAGGGGAGCTGGAAAGGGGATGG + Intergenic
1093731375 12:22569127-22569149 GAGGGGAGCTGGAAAGGGGATGG - Intergenic
1093749237 12:22779559-22779581 ATGGGGAACTGGAAAGGGGATGG + Intergenic
1093751791 12:22808083-22808105 ATGGGGAACTGGAAACAGGATGG + Intergenic
1093769100 12:22998980-22999002 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1093937760 12:25019410-25019432 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1094412602 12:30182931-30182953 ATGGGGAGCTGGAAAGGGAATGG - Intergenic
1094474979 12:30833880-30833902 ATGGGGCGCTGGAAAGGGGATGG - Intergenic
1094745605 12:33341227-33341249 ATGGGGAGCTGGAAAGGAGATGG + Intergenic
1095545554 12:43363713-43363735 GTGGTGTGTTGTTAAGAGGAGGG + Intronic
1095551887 12:43451862-43451884 ACAGAGAGCTGGAAAGAGGAAGG + Intronic
1096248910 12:50014373-50014395 GTGGTGAGCTGGGGAGAAAAAGG - Intronic
1096522545 12:52192252-52192274 GTGGGGAGTTGGCAAAAGGAAGG + Intergenic
1096591736 12:52664657-52664679 GGGGTGAGCTGGATGGAGGCAGG - Intergenic
1096633653 12:52945296-52945318 GGGGTGGGCTGGAGGGAGGAAGG - Intronic
1096990779 12:55800834-55800856 GAGGTGAGTTGGATAGAGTAAGG - Exonic
1097031841 12:56095366-56095388 GTGGTTACCTGGAGAGAAGAGGG + Intronic
1097066570 12:56324920-56324942 GAGGAGACCTGGAAAGAGCAGGG + Intronic
1097747852 12:63318836-63318858 GAGGGGAGCTGGAAAGGGGATGG + Intergenic
1097840946 12:64320572-64320594 ATGGTGAGCTGGAGAGAATAGGG - Intronic
1098218235 12:68242039-68242061 GTGGTAAGCTGGGCACAGGAGGG + Intergenic
1098314879 12:69182519-69182541 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1098554630 12:71804432-71804454 TTGGGGAGCTGGAAAGGGAATGG - Intergenic
1098757671 12:74386958-74386980 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1098758334 12:74391671-74391693 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1099398003 12:82165607-82165629 GTGGTGAGATGGAAGGAGATGGG + Intergenic
1099943665 12:89220207-89220229 GGGGTGAGGAGGAAAAAGGAGGG - Intergenic
1100085003 12:90900025-90900047 GTGGAGAGGTGGAAAGAGCTTGG - Intergenic
1100367871 12:93937957-93937979 AGGGTGAGCAGGAAAGAGCAGGG - Intergenic
1100387012 12:94112949-94112971 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
1100398970 12:94211268-94211290 GTGGTGAGCTGGAGAGAGTGAGG - Intronic
1100978504 12:100146035-100146057 ATGGGAAGCTGGAAAGGGGATGG + Intergenic
1101378039 12:104187853-104187875 ATGGGGAGTTGGAAAGGGGATGG + Intergenic
1101611381 12:106295523-106295545 GTGGTATGGTGGAAAGAGGGTGG - Intronic
1101611622 12:106297962-106297984 GTGGTGCCCAGGTAAGAGGAAGG + Intronic
1101799824 12:108011508-108011530 GTGGTGAACAGGAGTGAGGAAGG - Intergenic
1102851217 12:116246854-116246876 GTGGGGAGGTGGGGAGAGGAGGG + Intronic
1102871493 12:116417587-116417609 TAGGTGTTCTGGAAAGAGGATGG + Intergenic
1103028455 12:117593019-117593041 GCTATGATCTGGAAAGAGGAGGG + Intronic
1103038219 12:117673445-117673467 ATGGACAGATGGAAAGAGGAAGG + Intronic
1103148915 12:118619966-118619988 ATGGTGAACTGAAAAGAAGATGG - Intergenic
1103377073 12:120465367-120465389 GTGGTGAGAAGGAAAGATGATGG - Intronic
1103992111 12:124806213-124806235 GTGGGGAGCAAGAGAGAGGAAGG + Intronic
1104096813 12:125565602-125565624 GTGGGGAGCTGGAAGGGGGATGG + Intronic
1104143132 12:126007153-126007175 ATGGGGAGTTGGAAAGGGGATGG + Intergenic
1104235970 12:126936917-126936939 GAGGAGAGCTGGAGAGAGGATGG + Intergenic
1104265862 12:127231966-127231988 AAGGAGAGCTGGAAAGGGGATGG - Intergenic
1104285148 12:127418251-127418273 GAGGAGAGCTGGAAAGGGGTTGG - Intergenic
1104832264 12:131761438-131761460 GTGGTGTGCAGGAAAGAGGTTGG + Intronic
1105972984 13:25447827-25447849 ATGGGGAGCTGGAGAGGGGATGG + Intronic
1106339735 13:28817430-28817452 GTTGTGAGCTGGAAACAGCTGGG + Intergenic
1106882885 13:34150914-34150936 GTGATCAGGTGAAAAGAGGAAGG - Intergenic
1106942294 13:34792309-34792331 ATGAGGAGCTGGAAAGGGGATGG - Intergenic
1107294389 13:38894320-38894342 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1107698592 13:43024258-43024280 CTGTAGAGCTGGAAAAAGGAAGG + Intronic
1107771939 13:43796474-43796496 GAGTTGAGCTGGAAGGAGGAAGG - Intergenic
1107802003 13:44117055-44117077 GTGGGGATTGGGAAAGAGGATGG + Intergenic
1107808988 13:44181101-44181123 TTGGTGAGCTGGAACAAGAAGGG + Intergenic
1108104850 13:46997833-46997855 ATGAGGAGCTAGAAAGAGGACGG + Intergenic
1108158984 13:47618500-47618522 ATGGAGAGCTGGAAAGGGGATGG + Intergenic
1108159056 13:47618897-47618919 ATGGGGAGTTGGAAAGGGGATGG - Intergenic
1108254640 13:48598550-48598572 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
1108542526 13:51456934-51456956 GTGGAGAGCTGAGAAGATGACGG + Intergenic
1108559297 13:51627277-51627299 GTGGTGAGCGGGAAGGGGCAGGG + Intronic
1108799810 13:54081728-54081750 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1109300723 13:60587355-60587377 ATGGGAAGCTGGAAAGGGGATGG - Intergenic
1109470680 13:62799779-62799801 GCGGAGAGCTGGAAAGATGATGG + Intergenic
1109943563 13:69404110-69404132 GGGAAGTGCTGGAAAGAGGAAGG + Intergenic
1109943635 13:69404518-69404540 GTGGGGAGCCAGAAAGAGGATGG - Intergenic
1110003708 13:70238612-70238634 ATGAGGAGCTGGAAAGGGGATGG - Intergenic
1110231640 13:73173357-73173379 GTGTGGAGCTTGAAAAAGGATGG + Intergenic
1110277812 13:73659597-73659619 GTCGTGAGTTGGAAAGGGCATGG - Intergenic
1110433900 13:75458209-75458231 ATGGGGAGCTGGAAAGAGGATGG + Intronic
1110697101 13:78504024-78504046 GTGGTGAGCTGGCACTAGCATGG - Intergenic
1110714305 13:78683988-78684010 ATTGGGAGCTGGAAAGGGGATGG - Intergenic
1111073408 13:83200055-83200077 ATGGGGAGCTGGAAGGTGGATGG - Intergenic
1111451818 13:88428810-88428832 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1111453859 13:88453927-88453949 ATGGGGAGCTGGAAAGGGAATGG + Intergenic
1111726254 13:92013287-92013309 GAGGGGAGCTGGAGAGGGGATGG + Intronic
1111878124 13:93921496-93921518 ATGGGGAGCTAGAAAGGGGATGG + Intronic
1112118059 13:96379069-96379091 GTGGAGAAATGGAAAGAGGATGG - Intronic
1112171493 13:96977180-96977202 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1112259765 13:97867666-97867688 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1113936625 13:113998288-113998310 GAGGAGGGCTGGGAAGAGGAGGG - Intronic
1113937458 13:114001928-114001950 GTGGGGAGCAGGAGACAGGATGG + Intronic
1114320015 14:21539439-21539461 GTGGTGAAGTGGAGAGGGGAGGG + Intergenic
1114449029 14:22812848-22812870 GTGGAGGGCTGGACAGAGGCTGG - Intronic
1114517098 14:23307177-23307199 GTGGAGCCCTGGAAAGGGGAGGG - Exonic
1114674445 14:24431004-24431026 GAGGAGAGCAGGGAAGAGGAGGG + Intronic
1115899563 14:38129629-38129651 ATGGAGAGCTGGAAAGGGGATGG - Intergenic
1116526352 14:45910588-45910610 AAGGGGAGCTGGAAAGGGGATGG - Intergenic
1116789481 14:49325245-49325267 GTGGTGTGATGGAATGAGAAGGG + Intergenic
1117119678 14:52553538-52553560 GTGGAGAACTGGAGACAGGAGGG - Exonic
1117330405 14:54706679-54706701 GAGCTAAGATGGAAAGAGGAAGG + Intronic
1117390357 14:55256544-55256566 ATGGAGAGCTGGAAAGAGGATGG - Intergenic
1117830443 14:59744657-59744679 GTGTTGAGATTGAAAGGGGAAGG + Intronic
1117943997 14:60998483-60998505 ATGGGGAGCTGGAAAGGGGATGG - Intronic
1118319911 14:64747032-64747054 GTGGGGAGCTGGCAACAGAATGG + Exonic
1118474289 14:66102356-66102378 ATGGGGAGCTGGAAAGGTGATGG - Intergenic
1119021680 14:71121584-71121606 GAGGGGAGCTGGAGAGGGGACGG - Intergenic
1119085472 14:71735025-71735047 GTGATGAGCAGGGAAGAGGGGGG + Intronic
1119437042 14:74604414-74604436 GTGGCAAGCTGGTAGGAGGATGG + Intronic
1119922599 14:78460178-78460200 GTGGTGTGCTGGAGAGGGCATGG - Intronic
1120218376 14:81704993-81705015 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1120523277 14:85549063-85549085 ATGAAGAGCTGGAAAGGGGATGG - Intronic
1120894070 14:89514155-89514177 GTGGTGAGGGAGAAGGAGGATGG + Intronic
1121172709 14:91868157-91868179 ATGGGGAGCTGGACAGGGGATGG + Intergenic
1121666519 14:95676626-95676648 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
1121737468 14:96228463-96228485 GTGGGGAGCTGGAAAGGGGATGG + Intronic
1122406645 14:101504826-101504848 GTGGAGAGCTGGCAGGAGGTTGG + Intergenic
1122636281 14:103131203-103131225 GAGGGGAGCTGGAAGGTGGAGGG + Intronic
1122643326 14:103175353-103175375 AAGGGGAGCTGGAAAGGGGATGG - Intergenic
1122958302 14:105083041-105083063 GTGGAGGGGTGGAGAGAGGAGGG - Intergenic
1123124176 14:105933320-105933342 GTGGCCAGCAGGAAACAGGAAGG - Intergenic
1123185048 14:106508672-106508694 GTGATGAGCTGGGAAGAGGAAGG + Intergenic
1123205863 14:106712898-106712920 GGGATGAGCTGGGAAGAGGAAGG + Intergenic
1123210937 14:106760302-106760324 GGGATGATCTGGGAAGAGGAAGG + Intergenic
1123627922 15:22240010-22240032 GAGGTGAGGTGGAAGGTGGAGGG - Intergenic
1123880986 15:24677190-24677212 TTGGTGTGGTGGAAAGTGGAGGG - Exonic
1125338109 15:38647952-38647974 GTGGGGAGTTGCAAGGAGGAGGG + Intergenic
1125346496 15:38723875-38723897 GTGGTTGGCTGGGAAGAGTATGG + Intergenic
1125446899 15:39767795-39767817 ATGGGGAGCTGGAACGGGGATGG - Intronic
1125456518 15:39865552-39865574 GTGAGGAGGTGGAAGGAGGATGG + Intronic
1125796549 15:42408196-42408218 ATGATGGGCTGGAGAGAGGAGGG - Exonic
1125931732 15:43604937-43604959 GTGCTGAGCTGGGAGCAGGAGGG - Intronic
1126055937 15:44729443-44729465 GGGCAGAGCGGGAAAGAGGAGGG + Exonic
1126322929 15:47444986-47445008 ATGGGGAGCTGGAAGGGGGATGG + Intronic
1127761118 15:62140009-62140031 GGGGTCAGCTGGATAGAGGAAGG - Intergenic
1128302010 15:66571868-66571890 GTGGTGAGGAGGAAAGGGGAAGG + Intergenic
1128323467 15:66707858-66707880 ATGCTGAGCTGGAAAGATGGGGG + Intronic
1128816834 15:70616201-70616223 GTGGTTAGATGGAGAGAGTAGGG - Intergenic
1129394372 15:75236073-75236095 GTGGTGAACTGGGAGGAAGAGGG - Intergenic
1129530024 15:76258294-76258316 GTGCTGAGCCAGCAAGAGGAAGG - Intronic
1129653411 15:77507294-77507316 GTGGGGAGCAGGGAAGAGGAAGG - Intergenic
1129752025 15:78072228-78072250 CTGGTTAGCAGGAAATAGGATGG + Intronic
1129777961 15:78249377-78249399 GTGGTGGACTGGAAAGAACATGG + Intergenic
1129967641 15:79751151-79751173 GTGGTCAGCTGGAATGTGGGAGG - Intergenic
1130696502 15:86136768-86136790 GTGAGGAGCTGGGAGGAGGAAGG + Intergenic
1130747661 15:86673392-86673414 GTGGTGAGCTAGAAAGTGCGTGG - Intronic
1130803432 15:87291956-87291978 ATGGGGAGCTGGACAGGGGATGG + Intergenic
1130856306 15:87842601-87842623 GTGGTCAGCTGGTAAGAACAGGG - Intergenic
1131433653 15:92406088-92406110 CTGCTGAGCTGGGAAGAGGTAGG + Intronic
1131709515 15:95037817-95037839 ATGGGGAACTGGAAAGGGGATGG - Intergenic
1132318557 15:100908643-100908665 AGGGTGGGCTGGAGAGAGGAAGG - Intronic
1132421447 15:101673307-101673329 GTGGGGAGCTGAAAAGGGGATGG - Intronic
1133045660 16:3087091-3087113 GGGCTGAGCAGGAAGGAGGAAGG + Intergenic
1133047866 16:3099170-3099192 GTGGTGAGTTGGAGGGAGGTCGG - Intronic
1133071422 16:3249132-3249154 GGGGTGCTCAGGAAAGAGGAGGG + Intronic
1133107320 16:3520950-3520972 GTAGGCAGCTGGGAAGAGGAGGG - Intronic
1133297826 16:4763744-4763766 GTGGTGGCCAGGAAAGAGGCTGG + Intronic
1133493901 16:6297878-6297900 ATGGGGAGCTGGAAAGGGGATGG - Intronic
1133816786 16:9203712-9203734 ATGAGGAGCTGGAAAGGGGATGG - Intergenic
1134602330 16:15543118-15543140 AAGGGGAGCTGGAAAGGGGATGG + Intronic
1134815748 16:17204407-17204429 CTGGGGAGCTGCAAAGAGAATGG + Intronic
1134873680 16:17676191-17676213 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1134911727 16:18033114-18033136 GTGGTTAGCTCCTAAGAGGAAGG - Intergenic
1135010870 16:18877442-18877464 GTGGGGAGAGGGAACGAGGAAGG + Intronic
1135317757 16:21465027-21465049 GTGGGGAGAGGGAACGAGGAAGG + Intergenic
1135352196 16:21738515-21738537 ATGGGGAGCTAGAAAGGGGATGG + Intronic
1135370652 16:21896826-21896848 GTGGGGAGAGGGAACGAGGAAGG + Intergenic
1135441134 16:22473893-22473915 GTGGGGAGAGGGAACGAGGAAGG - Intergenic
1135450686 16:22554637-22554659 ATGGGGAGCTAGAAAGGGGATGG + Intergenic
1135672511 16:24387296-24387318 ATGGGGAGTTGGAAAGGGGATGG + Intergenic
1136125315 16:28175251-28175273 GAGGTGAGAGGGAAAGAGGCAGG - Intronic
1136327970 16:29546477-29546499 GTGGGGAGAGGGAACGAGGAAGG + Intergenic
1136397278 16:30000181-30000203 GTGGTGAGTGGGAAAGAGCCTGG + Intronic
1136476232 16:30515395-30515417 GGCATGAGCTGGAAAGAGGCTGG - Intronic
1136546698 16:30958517-30958539 GTTGGGAGGTGGAAAGAGGCTGG + Intronic
1136779622 16:32888078-32888100 GGAATGAGCTGGGAAGAGGAAGG - Intergenic
1136890996 16:33973440-33973462 GGGATGAGCTGGGAAGAGGAAGG + Intergenic
1137036429 16:35573564-35573586 CTGGTGGGCTGGATAAAGGAGGG + Intergenic
1137720387 16:50624310-50624332 GTGGTGAGCTGGTCACCGGAGGG - Intronic
1138416709 16:56875844-56875866 GAGGTGAGCTGGGTAGAGGTGGG - Intronic
1138918281 16:61494969-61494991 GTCATGAGAAGGAAAGAGGATGG - Intergenic
1139328051 16:66167103-66167125 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1139889401 16:70238966-70238988 GTGGGGAGAGGGAATGAGGAAGG + Intergenic
1140200615 16:72891759-72891781 GTGGTGAGGAGAAAAAAGGAAGG - Intronic
1140213698 16:72990590-72990612 GAGGAGAACTGGAAAGAAGAGGG - Intronic
1140461749 16:75145729-75145751 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1140963569 16:79941817-79941839 GTGGTGCCCTGATAAGAGGAAGG + Intergenic
1142301756 16:89262718-89262740 AAGGGGAGCTGGAAAGGGGATGG + Intergenic
1203082039 16_KI270728v1_random:1150166-1150188 GGGATGAGCTGGGAAGAGGAAGG - Intergenic
1142755753 17:2015490-2015512 TTGGAGAGGTGGCAAGAGGAGGG + Intronic
1143161405 17:4874041-4874063 TTGGTGTGGTGGAAAGAGCATGG - Intronic
1143488172 17:7266874-7266896 TTGGTTAGCTGGATAGAGGAAGG - Intergenic
1143581386 17:7829352-7829374 GTGCTCAGGTGGGAAGAGGAGGG - Intronic
1143706777 17:8703546-8703568 GAGGGGAGCTGGAGAGGGGATGG + Intergenic
1143962734 17:10734025-10734047 CTGGTGTGCTGGACAGAGGGAGG - Intergenic
1144252394 17:13430831-13430853 CTGGTGTGGTGGAAAGAAGAAGG - Intergenic
1144956867 17:19023073-19023095 GTGGTGAACAGGGAGGAGGATGG + Intronic
1145056452 17:19706804-19706826 GTGGGGAGCAGGAATGAGGTGGG - Intronic
1146824667 17:36012199-36012221 ATGTGGAGCTGGAAAGGGGATGG - Intergenic
1147338330 17:39739878-39739900 GGGGTGAGCAGGGAGGAGGAAGG - Intronic
1147463452 17:40591071-40591093 GTGGTATGGGGGAAAGAGGATGG - Intergenic
1148232766 17:45947221-45947243 GTGGTGGGCAGGAGAGAGGAGGG + Intronic
1148462197 17:47845285-47845307 GTGGAGAGGGGGAAAGAGGAAGG - Exonic
1148537768 17:48455162-48455184 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
1148693565 17:49546280-49546302 GTGGTGAGCTGGGTGGAGGTGGG + Intergenic
1148901899 17:50884788-50884810 GGGGAGAGGTGGAAAGAGGAAGG - Intergenic
1149402621 17:56313516-56313538 GCCTTGAGGTGGAAAGAGGATGG + Intronic
1149431414 17:56597442-56597464 GTGGGGAGTGGGGAAGAGGAGGG + Intergenic
1149722884 17:58863722-58863744 CTGGGGTGCTGGAAAGGGGATGG + Intronic
1150398048 17:64836573-64836595 TTGGGGAGCTGGACAGGGGATGG + Intergenic
1150931524 17:69590241-69590263 ATGGGGAGCTGGGAAGGGGATGG + Intergenic
1151018498 17:70584807-70584829 GAGGGGAGCTGGAGAGGGGATGG + Intergenic
1151833478 17:76569194-76569216 GTGGGGGGCTGGAAAAAGGGGGG + Intronic
1152374522 17:79912317-79912339 GTGGTGACCTTGTAAGAGGAGGG - Intergenic
1152434112 17:80264682-80264704 GTGCTGAGCAGGAAGCAGGAAGG - Intronic
1152442575 17:80317973-80317995 GAGGGGAGCTGGAGAGGGGATGG + Intronic
1152843054 17:82582304-82582326 GTGGAGAGCTGGCAACAGGAGGG - Intronic
1153681457 18:7504823-7504845 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1153741540 18:8134756-8134778 TTGGTCAGTTGTAAAGAGGAGGG - Intronic
1154350987 18:13583325-13583347 AAGGTGAGGTGGAGAGAGGATGG + Intronic
1155282975 18:24259540-24259562 TTCGTCAGCTGGAAGGAGGAAGG - Intronic
1155337796 18:24783202-24783224 GTGGAGATCTGGCAGGAGGAGGG - Intergenic
1155505854 18:26532087-26532109 GTGGTATGCTGGGATGAGGATGG + Intronic
1155528467 18:26741870-26741892 GTGGAGAGATGGAAAGAAGCCGG + Intergenic
1155637790 18:27975860-27975882 GAGGGGAGCTGGAAAGGGGATGG + Intronic
1155683705 18:28520914-28520936 ATGGGGAGCTGGAAAGAGGATGG - Intergenic
1155961311 18:31997643-31997665 GTGTTGATCTGGAAAGTTGAAGG + Intergenic
1156311529 18:35926830-35926852 ATGGGGAGCTGGAAAGGGAATGG - Intergenic
1156400644 18:36736508-36736530 AAGGAGAGCTGGAAAGGGGATGG + Intronic
1156608989 18:38703977-38703999 GTGGTTAAGTGGAAAGGGGATGG - Intergenic
1156651670 18:39233523-39233545 GAGGGGAGCTGGAAAGGGAATGG + Intergenic
1156905603 18:42348650-42348672 GAGGGGAGCTGGAAAGAGTATGG - Intergenic
1156911642 18:42417552-42417574 GAGGGGAGCTGGAGAGGGGATGG + Intergenic
1156933907 18:42679337-42679359 ATGGTGAGGTGGCAAGAGTATGG - Intergenic
1157648947 18:49307545-49307567 GTGGTCAGCTAAAATGAGGAAGG + Intronic
1157859228 18:51125759-51125781 ATGGGGAGCTAGAAAGAGAATGG + Intergenic
1158270763 18:55713295-55713317 GGGCTGAGCAGGAAGGAGGAAGG - Intergenic
1158290254 18:55932614-55932636 GAAGGGAGCTGGAAAGAGGATGG - Intergenic
1158898743 18:61940995-61941017 GTGGTGAGAGAGAGAGAGGAAGG + Intergenic
1158968542 18:62644671-62644693 AAGGGGAGCTGGAAAGAGGATGG - Intergenic
1159447392 18:68557524-68557546 GTGGGGAATTGGAAAGGGGATGG + Intergenic
1159726578 18:71967858-71967880 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1159779602 18:72645835-72645857 GATGTGAGCTGGAGAGGGGAGGG - Intergenic
1160127468 18:76189597-76189619 ATGGGGAGATGGAAAGTGGATGG - Intergenic
1160149454 18:76388113-76388135 ATGAGGAGCTGGAAAGGGGATGG - Intronic
1160550898 18:79693202-79693224 GTGGTGACCGGGAGGGAGGATGG + Intronic
1161410371 19:4113611-4113633 GTGGTGTCCTGGAAAGAATACGG - Intronic
1161637327 19:5397036-5397058 GTGGTGATGTGGAAACAGCAGGG - Intergenic
1162740913 19:12773106-12773128 GAAGTGAGGTGGAGAGAGGATGG - Intronic
1162771570 19:12952621-12952643 GTGATGACCTGGGGAGAGGAGGG + Intronic
1162893014 19:13747710-13747732 GTAGTGGGCTGGACAGAGGATGG + Intronic
1163263905 19:16206946-16206968 GAGGTCAGCTGGGAAGAGGGCGG + Intronic
1164579834 19:29428046-29428068 GTGGTGGGGAGGATAGAGGAAGG - Intergenic
1164781096 19:30893454-30893476 GTGGTCAACTGGCAAGAGAAAGG + Intergenic
1164794393 19:31014557-31014579 GAGGTGAGAGGGAAGGAGGAAGG + Intergenic
1165741354 19:38207027-38207049 CTGGTTAGCTGGAAGGTGGAGGG - Exonic
1167055050 19:47105134-47105156 GTGGTGGGAAGGAATGAGGAGGG - Intronic
1167270573 19:48503492-48503514 GAGGTGAGGTGTAAGGAGGAAGG - Intronic
1167435164 19:49474859-49474881 ATGGGGAGATGGACAGAGGAGGG + Intronic
1167435181 19:49474928-49474950 GCGGGGAGATGGACAGAGGAGGG + Intronic
1167435259 19:49475219-49475241 GGGGGGAGATGGACAGAGGAGGG + Intronic
1167469096 19:49665566-49665588 GCGAGGAGCGGGAAAGAGGATGG - Exonic
1167469213 19:49666092-49666114 GGGGTGAGGAGGGAAGAGGAGGG + Intronic
1167469788 19:49669207-49669229 ATGGTCAGGTGGAAAGAGGCTGG + Intronic
1167789379 19:51663615-51663637 GTGGTGAGGAGGAAAAAGAAAGG - Intergenic
1168509263 19:56961527-56961549 GAGGGGAGGGGGAAAGAGGAGGG - Intergenic
1168647106 19:58066660-58066682 GTGGTGAGATGGGAAGAGGAAGG - Intronic
1202645244 1_KI270706v1_random:133234-133256 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
925340296 2:3131241-3131263 GTGGTGAGCTGGAGAGACCCTGG + Intergenic
925488003 2:4357764-4357786 ATGGGGAGCAGGAAAGAGCAAGG - Intergenic
925675926 2:6360910-6360932 GTAGGGAGCTGGAAAGGGGGAGG + Intergenic
925706324 2:6687083-6687105 ATGGGGAGCTGGAAAGGAGATGG + Intergenic
925869932 2:8261302-8261324 GTGGTGAGATGGAATGAGAAAGG + Intergenic
925886184 2:8395239-8395261 AAGGGGAGTTGGAAAGAGGAGGG - Intergenic
926162920 2:10501165-10501187 AGGGTGAGCAGGAAAGTGGATGG - Intergenic
926464846 2:13175552-13175574 ATGGGGAGCTAGAAAGGGGATGG + Intergenic
926644936 2:15280325-15280347 GTGCTTAGAAGGAAAGAGGAAGG + Intronic
926814124 2:16783527-16783549 GTGGTGAGCTTGCTAGAGTATGG + Intergenic
927088113 2:19690320-19690342 GAGGTGGGGAGGAAAGAGGAGGG + Intergenic
927925735 2:27012342-27012364 GTGGTGGTGTGGAAAGAGCATGG + Intronic
927936359 2:27078864-27078886 GAGCTGAGGAGGAAAGAGGAGGG + Exonic
928110987 2:28508677-28508699 CTGGTGAGCTTGGAAGGGGAGGG - Intronic
928494026 2:31813456-31813478 ATGGGGAGCTAGAAAGTGGATGG + Intergenic
928664492 2:33537119-33537141 ATGGGGAGCTGGAAAGGGGATGG + Intronic
928869662 2:35961502-35961524 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
929780993 2:44956840-44956862 CAGGTGGTCTGGAAAGAGGATGG + Intergenic
929892746 2:45932086-45932108 GTAGTGAGCAGAAGAGAGGATGG - Intronic
930088998 2:47518337-47518359 GTTGGGAGGTGGGAAGAGGAAGG + Exonic
930320106 2:49843728-49843750 AAGGGGAGCTGGAAAGGGGATGG + Intergenic
930525523 2:52524825-52524847 GAGGGGAGCTGAAAAGGGGATGG - Intergenic
930726633 2:54687906-54687928 GTAGTCATCTGGGAAGAGGAAGG + Intergenic
931131465 2:59341159-59341181 CTGGAGATCTGGAAAGAGGGTGG + Intergenic
931426513 2:62176883-62176905 GTGGTGAGGTGGCAGGAGGGAGG - Intergenic
931550961 2:63445769-63445791 GTGGTGAGAAGTAAAGAGAAAGG + Intronic
931567254 2:63627729-63627751 GTGCTCAGCTGGAAAGGGAATGG - Intronic
931648183 2:64444379-64444401 GTGGGGAGCAGGAGAGAGCATGG + Intergenic
932140404 2:69272432-69272454 GTGGTGAGCTTTAAAGTGGGGGG + Intergenic
932369344 2:71174567-71174589 GTGGAGAGCTGCAGAGGGGAAGG + Intergenic
932573200 2:72949062-72949084 GTGGTGAGCCAGGAAGAGAATGG + Intronic
932827269 2:74953025-74953047 ATGGGGAGTTGGAAAGGGGATGG + Intergenic
933425949 2:82112540-82112562 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
933895361 2:86806360-86806382 GTGTGGACCTGGAAAAAGGAAGG + Intronic
933901505 2:86853620-86853642 TTGGTGTCCTGGAGAGAGGAAGG + Intronic
934507649 2:94906820-94906842 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
934791760 2:97068090-97068112 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
934913338 2:98278544-98278566 ATGGAGAGCTAGAAAGGGGATGG + Intronic
934969363 2:98750589-98750611 ATAGGGAGTTGGAAAGAGGATGG - Intergenic
935175903 2:100648524-100648546 AAGGGGAGCTGGAAAGGGGATGG - Intergenic
935534788 2:104281635-104281657 GTGGGGGGATGGTAAGAGGAGGG - Intergenic
936288095 2:111197187-111197209 TTGGTGAGCTGGAAACACAATGG + Intergenic
936564362 2:113571665-113571687 CAGGAGAGCTGGACAGAGGAAGG + Intergenic
936647544 2:114389053-114389075 ATGGGGAGCTGGAAATGGGATGG - Intergenic
936657621 2:114506337-114506359 AAGGGGAGCTGGAAAGGGGATGG - Intronic
937060530 2:118977588-118977610 GTGGGGCTGTGGAAAGAGGATGG - Intronic
937096537 2:119239205-119239227 GTGTAGAGAGGGAAAGAGGAAGG - Intronic
937476201 2:122217725-122217747 ATGGTGAGCTGCAAAGACGTGGG - Intergenic
937840401 2:126519068-126519090 ATGAAGAGCTGGAAAGGGGATGG - Intergenic
937869265 2:126776276-126776298 GTGCAGAGCTGGGAAGAGGGAGG + Intergenic
937988750 2:127650597-127650619 GTGCTGAGCTTGAAAGTGGGAGG + Intronic
938035035 2:128028167-128028189 GTCGTGAGCGGGAGAGCGGACGG + Intergenic
938699526 2:133863577-133863599 ATGGGGAGCTGCAAAGGGGATGG + Intergenic
939245089 2:139613162-139613184 ATGGGGTGCTGGAAAGGGGATGG - Intergenic
939340974 2:140895733-140895755 ATGGAGAGCTGAAAAGGGGATGG + Intronic
939388528 2:141534567-141534589 GTGTTGAGCTGGAAAGACAGTGG - Intronic
940173140 2:150850061-150850083 GAGGGGAGCTGGAAAGGGGATGG + Intergenic
940658698 2:156520057-156520079 ATGGGGAGCTGGAAAGGGGATGG + Intronic
940660014 2:156534120-156534142 ATGGGGAGCTAGAAAGGGGATGG + Intronic
941717529 2:168779713-168779735 ATGGGGAGTTGGAAAGGGGATGG - Intergenic
941880578 2:170476487-170476509 ATGGAGAGCTGGAATGGGGATGG + Intronic
941996411 2:171605691-171605713 GATGGGAGCTGGAAAGTGGATGG + Intergenic
942173341 2:173308379-173308401 ATGGGGATCTGGAAAGAGAATGG - Intergenic
943710375 2:191087498-191087520 GTAGTGGGATGGAAAGGGGAGGG - Intronic
943746036 2:191463631-191463653 ATGCAGAGCTGGAAAGCGGATGG + Intergenic
943749191 2:191494081-191494103 ATGGGGAGCTGGAAAGGAGATGG + Intergenic
943879176 2:193117151-193117173 GAGCTGAGCTGGAAAGAGCTGGG + Intergenic
944024146 2:195143389-195143411 ATGGGGAGTTGGAAAGGGGATGG + Intergenic
944058688 2:195548699-195548721 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
944221971 2:197311341-197311363 GTGTTTAGCTGGAAAGTGGCTGG - Intergenic
944839683 2:203612989-203613011 ATATTCAGCTGGAAAGAGGAAGG + Intergenic
945047979 2:205798692-205798714 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
945531867 2:210965348-210965370 GTGGTGAGCTGGCAGGAAGGTGG - Intergenic
946067219 2:216998229-216998251 GTGGTGCACTGGTAAGAGCATGG + Intergenic
946191736 2:218011171-218011193 GTGCTCAGCTGAACAGAGGATGG + Intergenic
946191872 2:218011722-218011744 GTGGGGAGCTGCAATGGGGACGG - Intergenic
946347829 2:219125488-219125510 GTGGCCGGCTGGAAAGAGGAGGG - Intronic
946411423 2:219517099-219517121 GGGGTGGGCAGGAAAGGGGAAGG + Intronic
946474079 2:219991189-219991211 GAATTGGGCTGGAAAGAGGAAGG - Intergenic
946506942 2:220311961-220311983 GTGGAGGACTGGACAGAGGACGG - Intergenic
946609397 2:221441440-221441462 ATGGGGAGCTGGAAAGGGGAAGG - Intronic
946811539 2:223530776-223530798 GAGGAGAGCTGGAGAGAGGATGG - Intergenic
947368344 2:229419467-229419489 GTTGTGAGCTGGAAAGGCTAGGG - Intronic
947401132 2:229732558-229732580 ATGGGGAACTGGAAAGAGGATGG - Intergenic
947552155 2:231053952-231053974 GTCGTGGTCTGGAAAGAAGAAGG + Intergenic
947701853 2:232241011-232241033 GTGGGGAGCTGGGTGGAGGAAGG + Intronic
949050152 2:241893459-241893481 GTGGTCTCCTGGACAGAGGAGGG - Intergenic
1169209730 20:3759322-3759344 ATGGTGGGCTAGACAGAGGAAGG - Intronic
1169360888 20:4948026-4948048 GGACTGTGCTGGAAAGAGGATGG - Intronic
1169864525 20:10185673-10185695 GTGGTAAGGTGGAAGGAGGAAGG + Intergenic
1169896677 20:10511612-10511634 GTGGTGAGCATCAAAGAAGATGG - Intronic
1170889493 20:20366620-20366642 GGGCTGGGCTGGACAGAGGATGG + Intergenic
1171139497 20:22728823-22728845 ATGGAGGACTGGAAAGAGGAGGG + Intergenic
1171211566 20:23321011-23321033 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1171824235 20:29879320-29879342 TGGGTGAACTGGATAGAGGAGGG + Intergenic
1171895207 20:30752154-30752176 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1172396202 20:34607511-34607533 ATGGAGAGCTGGAAAGGGGATGG - Intronic
1173208271 20:41011805-41011827 GTGGTCAGCTGAAGAGTGGATGG + Intergenic
1173369928 20:42426417-42426439 ATGGGGAGGTGGAAAGGGGATGG - Intronic
1173885762 20:46457636-46457658 ATGGCGAGCTGGACTGAGGATGG - Intergenic
1173885765 20:46457655-46457677 GAGGTGAGCTGGGCTGAGGATGG - Intergenic
1173907988 20:46642633-46642655 GTGGTAAGATGAAGAGAGGAAGG - Intronic
1174028786 20:47603652-47603674 ATGAGGAGCTGGAAAGGGGATGG + Intronic
1174073275 20:47913761-47913783 GAGGTGAGATAGAAAGAGAAGGG + Intergenic
1174191597 20:48744493-48744515 GTGGTAGGCTGGAAGAAGGAAGG - Intronic
1174418473 20:50383671-50383693 GAGCTGAACTGAAAAGAGGATGG - Intergenic
1174891132 20:54395735-54395757 GTGGAGAGATGGAATCAGGATGG + Intergenic
1174970413 20:55268867-55268889 GTGGCTGGCTGGCAAGAGGAAGG + Intergenic
1174983926 20:55428303-55428325 ACAGTGAGCTGGAAAGAGGTGGG + Intergenic
1175526860 20:59640384-59640406 GATGTGAGCTGGATAGAGCAAGG + Intronic
1176411816 21:6453326-6453348 GTGGTGACAGGGAAAGTGGAAGG - Intergenic
1176606641 21:8839508-8839530 ATGGGAAGCTGGAAAGGGGATGG + Intergenic
1176980493 21:15375897-15375919 ATGGGGAGCTGGAAATGGGATGG - Intergenic
1176981013 21:15381046-15381068 ATGGGGAGCTGGAAAGGGAATGG - Intergenic
1176981525 21:15386790-15386812 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1177286713 21:19061147-19061169 GTGGTGTGATGTAGAGAGGAGGG - Intergenic
1177542465 21:22512568-22512590 ATTGTGTGCTGGAAAGGGGAAGG + Intergenic
1177968460 21:27759089-27759111 GAGGGGAGATGGAAAGGGGATGG - Intergenic
1178087048 21:29122515-29122537 ATGGAGAGCTGGAAAGGGGATGG + Intronic
1178094292 21:29197488-29197510 ATGGGGAGCTGGGAGGAGGATGG - Intronic
1178135685 21:29624869-29624891 GACGTGAGCTGGAGAGTGGATGG - Intronic
1178199831 21:30390911-30390933 GTGGGGAGCTAGAAGGGGGATGG - Intronic
1178213738 21:30569208-30569230 ATGGGGAGCTGGAAGGTGGAGGG - Intergenic
1178818078 21:35949903-35949925 GTGATGAGATGGGATGAGGATGG - Intronic
1179687310 21:43061648-43061670 GTGGTGACAGGGAAAGTGGAAGG - Intronic
1180356715 22:11849210-11849232 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1180381546 22:12143121-12143143 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1181550818 22:23638259-23638281 GGGTTGAGCTGCAAGGAGGAAGG + Intergenic
1181710216 22:24679776-24679798 GTGGTGAGCGGGAGAGTAGAGGG + Intergenic
1181757459 22:25034369-25034391 GTGATGGGCTGGGAAGAGCAGGG - Intronic
1181865405 22:25850925-25850947 GTGGGGAACTGGGAAGAGAAGGG - Intronic
1182844423 22:33418720-33418742 GGAGTGAGCAGGGAAGAGGAGGG + Intronic
1183258337 22:36777572-36777594 GAGGGGAGCCGGCAAGAGGAAGG - Intergenic
1183324818 22:37185448-37185470 ATGGTGACCTGGAACAAGGAAGG + Exonic
1184067154 22:42127412-42127434 GTGCTGAGCTGGGGTGAGGAGGG + Intronic
1184069879 22:42141117-42141139 GTGCTGAGCTGGGGTGAGGAGGG + Intergenic
1184071626 22:42150720-42150742 GTGCTGAGCTGGGGTGAGGAGGG + Intergenic
1184658034 22:45951999-45952021 GCAGTGAGCTGGAAGGAGGGGGG + Intronic
1184866574 22:47204934-47204956 GGGGTGAGCTAGAGAGAGCAGGG + Intergenic
1185297774 22:50062645-50062667 GTGGTGTGCTGAACACAGGAGGG + Intronic
949437982 3:4049896-4049918 ATGGGGAGCTGGAAGGGGGATGG + Intronic
949464758 3:4333027-4333049 ATGGGGAGCTGGATAGGGGATGG - Intronic
949512048 3:4774922-4774944 GGGGTGGGCAGGAGAGAGGAAGG + Intronic
949675439 3:6447920-6447942 GAGGGGAGCTGGGAAGGGGACGG + Intergenic
949684208 3:6549505-6549527 ATGAGGAGCTGGAAAGGGGATGG - Intergenic
949802107 3:7915266-7915288 ATGGGGAGCTGGACAGGGGATGG - Intergenic
950108100 3:10401071-10401093 GAGGTCACCTGGCAAGAGGAAGG + Exonic
950204440 3:11067920-11067942 ATGGGAAGCTGGAAAGGGGATGG - Intergenic
950254477 3:11493172-11493194 GAGGGGAGCTGGAAAGGGGGTGG + Intronic
950257535 3:11518064-11518086 ATGGTGAGTGGGAGAGAGGAAGG + Intronic
950519444 3:13487915-13487937 GGGGAGAGCTGGTGAGAGGATGG + Intronic
951004353 3:17599455-17599477 ATGGGGAGCTGGAAAGGGGATGG - Intronic
951501331 3:23390434-23390456 AAGGGGAGCTGGAAAGGGGATGG - Intronic
951526406 3:23657070-23657092 GTGGGCTGGTGGAAAGAGGAGGG + Intergenic
951651379 3:24955173-24955195 AAGGGGAGCTGGAAAGGGGATGG + Intergenic
951651830 3:24959341-24959363 AAGGGGAGCTGGAAAGGGGATGG + Intergenic
951731616 3:25816014-25816036 ATGGGGAGCTGGACAGGGGATGG - Intergenic
952039212 3:29241318-29241340 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
955038714 3:55293727-55293749 GTGGGGAGCTGAAAAGTGAATGG - Intergenic
955049396 3:55394665-55394687 GTGGGGTGCGGGAAAGGGGAAGG + Intergenic
955316064 3:57940205-57940227 GGGGTCAGCTGGAAAGCAGAGGG + Intergenic
955588971 3:60514045-60514067 ATGGGGAGCTGGAAAGGGAATGG - Intronic
955969202 3:64420135-64420157 GTGGGGAGGTGGGAAGAGAATGG + Intronic
956301277 3:67775174-67775196 GAGGGGAGCTGGAGAGAGGGTGG + Intergenic
956513574 3:70021152-70021174 GTGGGGAGGTGGGAAGAGAAGGG + Intergenic
956966717 3:74470384-74470406 GTGGTGAGCTGGAATGGAGAAGG - Intronic
957244706 3:77702378-77702400 GTGGAGAGCTGGAAAGGGGATGG - Intergenic
957297911 3:78355519-78355541 GTGAAGAGCTGAAAAGGGGATGG + Intergenic
957586530 3:82139413-82139435 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
957758413 3:84522776-84522798 ATGGGGAGCTAGAAAGGGGATGG - Intergenic
957984964 3:87562462-87562484 ATGGGAAGCTGGAAAGGGGATGG - Intergenic
958023675 3:88026268-88026290 ATAGGGAGCTGGAAAGGGGATGG + Intergenic
958023953 3:88028435-88028457 ATGGAGAACTGGAAAGGGGATGG - Intergenic
958100220 3:88999360-88999382 AAGGGGAGCTGGAAAGGGGATGG - Intergenic
958524684 3:95240810-95240832 ATGGAGAGCTAGAAAGAGGATGG + Intergenic
958973411 3:100638312-100638334 GAGGGGAGCTGGAAAGTGGGTGG + Intronic
959065213 3:101648982-101649004 ATGGGGAGCTGGAAAGGGGATGG + Exonic
959164387 3:102758731-102758753 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
959254090 3:103989072-103989094 GTGAGGAGCTGGAAGTAGGATGG + Intergenic
959375512 3:105584334-105584356 ATGGGGAGTTGGAAAGGGGATGG - Intergenic
959486634 3:106934500-106934522 GTGGGGAACTGGAAAGGGGATGG - Intergenic
959694186 3:109231873-109231895 ATGGGGAGCTGGAAAGTGGATGG - Intergenic
959985408 3:112565819-112565841 GTGGTTGGCTGGAGAGAGGTTGG + Intronic
960053338 3:113258368-113258390 GGGGTGAGCGGGGAACAGGATGG - Intronic
960326194 3:116298966-116298988 GTGGGGAGTGGGAAAGAGAATGG + Intronic
960358178 3:116678771-116678793 ATGGAGAGCTGGAATGGGGATGG - Intronic
960575006 3:119220654-119220676 GGGGTGAGCTGGAGTGGGGAGGG + Intronic
961671527 3:128535368-128535390 GTGTTGAGCTGGGAAGAGCCTGG + Intergenic
962380560 3:134895208-134895230 AAGCTGAGCTGGAAAGAGCAAGG - Intronic
963451700 3:145490420-145490442 AAGGGGAGCTGAAAAGAGGATGG - Intergenic
963762202 3:149295276-149295298 CTGGGGAGCTGGAAAGGGGATGG - Intergenic
963934929 3:151042750-151042772 GTGGTGGGCAGGCAAGAGAAGGG - Intergenic
964246812 3:154663430-154663452 GTGGAGAGTTGGAATGAGTAAGG - Intergenic
964247453 3:154669976-154669998 ATGGGGAGCTGGAAAGGGCATGG - Intergenic
964307541 3:155357146-155357168 GAGGGGAGCTGGAAAGAAGCAGG + Intergenic
964920546 3:161890770-161890792 GAGGGGAGCTGGAAAGGGGATGG + Intergenic
965085319 3:164088750-164088772 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
965208424 3:165751643-165751665 ATGGAGAGCTGGAAAGGGAATGG - Intergenic
965300827 3:167002553-167002575 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
965811127 3:172592594-172592616 GTGGTCAGGCGGAAACAGGATGG + Intergenic
966277691 3:178195282-178195304 GTGGTCAGCTGTGAAGAGGGTGG - Intergenic
966863727 3:184244724-184244746 GGGGTGAGCAGGGGAGAGGAAGG + Intronic
967210703 3:187165902-187165924 GTGTTGAGGTGGAAAGAGTCTGG + Intronic
967926520 3:194653212-194653234 GTTGTAAGATGGACAGAGGATGG + Intronic
968075609 3:195814530-195814552 GAGGGGAGCTGGAAAGCAGAAGG - Intergenic
968755396 4:2413332-2413354 GTGCTGATGTGGAAAAAGGAAGG + Intronic
969131603 4:4994687-4994709 GTGGTGGGCTGGGGAGAGGTAGG + Intergenic
969476344 4:7424570-7424592 GTGAGGAGCGGCAAAGAGGAGGG - Intronic
969526589 4:7706941-7706963 GTGGTGAGCAGGAAAGCAGCAGG - Intronic
969555617 4:7907163-7907185 GGAATTAGCTGGAAAGAGGAGGG - Intronic
970046641 4:11861847-11861869 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
970874098 4:20849545-20849567 GTGGTCAGATGTGAAGAGGATGG + Intronic
970926289 4:21456262-21456284 TTGGTGAACTGGAAAGGGCAAGG - Intronic
970943321 4:21661183-21661205 ATGGGGAGCTGGAAAGGAGATGG - Intronic
970979715 4:22082078-22082100 GTGGTGAGAGGCAATGAGGAGGG + Intergenic
971051034 4:22862952-22862974 GTGGTGAGCTGGCAAATGAATGG + Intergenic
971742677 4:30540152-30540174 ATGGGGATCTGGAAAGGGGATGG + Intergenic
971787505 4:31123812-31123834 ATGGGGGTCTGGAAAGAGGATGG + Intronic
971796823 4:31238931-31238953 ATGGGAAGCTGGAAAGGGGATGG + Intergenic
971840239 4:31842198-31842220 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
972613028 4:40672627-40672649 GGAGTGAGCCGGAAAGAGGAAGG + Intergenic
973193125 4:47409377-47409399 ATGGGGAGCTGGAAAGAGGCTGG + Intronic
973253559 4:48085808-48085830 ATGGGGAGCTGGAAATGGGATGG - Intronic
973371471 4:49251649-49251671 ATGGGAAGCTGGAAAGGGGATGG - Intergenic
973389537 4:49543662-49543684 ATGGGAAGCTGGAAAGGGGATGG + Intergenic
973696247 4:53493831-53493853 GTGGAGAGCTGAAAAGAGAAGGG - Intronic
974368639 4:60985699-60985721 ATGGGGAGCTAGAAAGGGGATGG + Intergenic
975060096 4:69986200-69986222 GTGAGGAGCTGGAAAAGGGATGG + Intergenic
975104615 4:70553763-70553785 GTGGTGAACAGGAAAGACAATGG - Intergenic
975580909 4:75906346-75906368 ATGGGGAGCTGGAACGGGGACGG - Intergenic
975730792 4:77335335-77335357 GTGGTGAACTGGAAATTCGAGGG + Intronic
976330216 4:83823041-83823063 GTGGGGAGCTGGAGAGATGCAGG - Intergenic
976367607 4:84247441-84247463 GAGGGGAGGTGGAGAGAGGACGG - Intergenic
976658086 4:87510592-87510614 GAGGTGAGCTGGAAAGGGAATGG - Intronic
976839902 4:89419925-89419947 GTGTTAAGCTGGATAGTGGATGG - Intergenic
976883602 4:89960483-89960505 AGGGTGAGCTGGAAAGGGGATGG + Intergenic
976955012 4:90885616-90885638 TTGGTGTGCTGGAACGATGATGG + Intronic
977306295 4:95327773-95327795 AAGGGGAGCTGGAAGGAGGATGG - Intronic
978643712 4:110902855-110902877 GTGGTTAGCCTGGAAGAGGAAGG + Intergenic
978735453 4:112079020-112079042 GTGCTTAGATGAAAAGAGGAGGG - Intergenic
978760415 4:112351270-112351292 GCAGTGAACTGGACAGAGGAGGG + Intronic
979117909 4:116850843-116850865 GTGGTGAGCTGGAAGTAGGGGGG - Intergenic
979167706 4:117557577-117557599 TTGGTGAGGAGGAAAGAGGTGGG + Intergenic
979621670 4:122805174-122805196 GTGGTGAGGTGTAATTAGGAAGG + Intergenic
979727604 4:123982842-123982864 GTGGGGAGCTGGAAAAGGGATGG + Intergenic
979728403 4:123992247-123992269 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
979919309 4:126478520-126478542 ATGGGGAGCTGGAAAGAAGATGG - Intergenic
980006148 4:127544562-127544584 ATGTGGAGCTGGAAAGGGGATGG - Intergenic
980097039 4:128501894-128501916 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
980097313 4:128504692-128504714 ATGGAGAGCTGGAAAGGGGATGG + Intergenic
980554610 4:134387052-134387074 ATGGGGAGCTGGAAAAGGGATGG - Intergenic
980871459 4:138615753-138615775 ATGGGGACCTGGAAAGGGGATGG - Intergenic
981143195 4:141294570-141294592 GTAGTGATTTTGAAAGAGGAGGG - Intergenic
981362769 4:143866549-143866571 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
981373502 4:143987349-143987371 ATGGAGAGCTGGAAAGGGGATGG - Intergenic
981382603 4:144090620-144090642 ATGGAGAGTTGGAAAGGGGATGG - Intergenic
981592247 4:146376602-146376624 ATGGGGAGCTGGAAAGGGGATGG - Intronic
981626683 4:146764390-146764412 GTGGGGAGGAGGAGAGAGGAGGG + Intronic
981815859 4:148829867-148829889 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
982074272 4:151722817-151722839 GTGCTGAGCTCAAAGGAGGAGGG + Intronic
982324802 4:154119394-154119416 AAGGTGAGCTGGGAGGAGGAAGG + Intergenic
982325809 4:154127277-154127299 GTGGGGAGCTAGAAAGGGGATGG + Intergenic
982794702 4:159630611-159630633 GTGTTGAGTTGGAGGGAGGAAGG + Intergenic
982918461 4:161244615-161244637 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
983172532 4:164552112-164552134 GAGGGGAGCTGGAAAGGGGATGG + Intergenic
983265505 4:165503931-165503953 GAGGTAAGGTGGAAACAGGATGG - Intergenic
983651495 4:170040707-170040729 GTGGAGAGCTGGGAAGATGATGG + Intergenic
983697872 4:170554634-170554656 GAGGGGAGCTGGAAAGGGGATGG + Intergenic
983698669 4:170564926-170564948 ATGGTGAAATGGAAAGAGCATGG - Intergenic
984098059 4:175455508-175455530 ATGGGGAACTGGAAAGGGGATGG + Intergenic
984105554 4:175541175-175541197 GAGGGGAGCTAGAAAGGGGATGG + Intergenic
984129543 4:175856694-175856716 ATGGGGACCTGGAAAGGGGATGG + Intronic
984300572 4:177912119-177912141 AAGGGGAGCTGGAAAGGGGATGG + Intronic
984333814 4:178361420-178361442 GAGGTGAGTTGAAAGGAGGAAGG - Intergenic
984417217 4:179477203-179477225 GTGGGGAGCTGGAAATGGGATGG - Intergenic
984718817 4:182951668-182951690 ATGCGGAGCTGGAAAGAGGATGG + Intergenic
984829308 4:183956963-183956985 GTGGTGTTCTGGACACAGGAAGG + Intronic
985228143 4:187784675-187784697 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
985288030 4:188356993-188357015 GTGGGGTTCTGGAAAGAGCAGGG + Intergenic
985293181 4:188407019-188407041 ATGGGGAGCTGGAAGGTGGATGG - Intergenic
985699636 5:1362791-1362813 TTGCTGAACTAGAAAGAGGATGG - Intergenic
986230964 5:5864561-5864583 ATGGGGAGCTGGAAGGTGGAGGG + Intergenic
986305155 5:6509051-6509073 GTGGTGACCTTCACAGAGGAAGG - Intergenic
986535243 5:8779856-8779878 TTGGTGTGCTGGAAATAGTAAGG - Intergenic
986588699 5:9346281-9346303 AAGGGGAGCTGGAAAGGGGATGG - Intronic
986669767 5:10132515-10132537 GAGGACAGCTGGAAAGAGGATGG + Intergenic
987190225 5:15469921-15469943 ATGGGGAGCTGGTAAGGGGATGG + Intergenic
987233276 5:15917130-15917152 CTGTTGAGGTGGAAAGAGCATGG - Intronic
987246717 5:16056444-16056466 GTGGTGTGCTTGAAAGATGGAGG + Intergenic
987251755 5:16107906-16107928 ATGGGGAGCTGGAAGGGGGATGG - Intronic
987268448 5:16280081-16280103 ATGGAGAGCTGGAAAGGAGATGG + Intergenic
987278073 5:16383331-16383353 GTAATGAGGTGGAAAGAGCATGG - Intergenic
987565897 5:19585817-19585839 GTGATGAGGTGGAGAGAGAATGG - Intronic
987715057 5:21557734-21557756 ATGGGGAGTTGGAAAGGGGATGG + Intergenic
988457621 5:31400641-31400663 ATGGGGAGCAGGAAGGAGGAGGG - Exonic
988603590 5:32661662-32661684 GAGGGGAGCTGGAGAGGGGATGG + Intergenic
988776519 5:34482303-34482325 GTGGGGAGCTGGGAAGGGGATGG - Intergenic
988908707 5:35817451-35817473 GTGGTGTGGAGGAAAGAGCATGG - Intergenic
988922845 5:35960800-35960822 ATGGGGAGCTGGAAAGGAGACGG + Intronic
989552983 5:42757284-42757306 GAGGTGAGGAGGAAAGAGGAGGG + Intronic
989558597 5:42825591-42825613 ATGGGGAGCTGGAAAGCGGATGG - Intronic
989687808 5:44110067-44110089 AAGGGGAGCTGGAAAGGGGATGG - Intergenic
989719123 5:44504014-44504036 TTGGGGAGCTGGAAGGGGGATGG - Intergenic
990073810 5:51817652-51817674 GTGCTGAGGGGGAAAGAGAAGGG + Intergenic
990079843 5:51899500-51899522 ATGGGGAACTGGAAAGAGGATGG + Intergenic
990128405 5:52548322-52548344 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
990379721 5:55210925-55210947 ATGGGGAGGTGGTAAGAGGAAGG + Intergenic
990488910 5:56284876-56284898 GAGGAGCCCTGGAAAGAGGAAGG - Intergenic
990499023 5:56376539-56376561 ATGGGGAGCTGGAGAGGGGATGG + Intergenic
991028728 5:62059668-62059690 GTGGTGAGAAGGAAAGATGGAGG - Intergenic
991082333 5:62614901-62614923 ATGGGGAGCTGGAAAGGGTATGG + Intronic
991185924 5:63807300-63807322 GTAGTGTGCTGGAAAGAGAGTGG + Intergenic
991207450 5:64065892-64065914 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
991425725 5:66489736-66489758 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
991644996 5:68792664-68792686 TTGGGGATCTGGAAAGGGGATGG + Intergenic
992160091 5:73992667-73992689 ATAAGGAGCTGGAAAGAGGATGG + Intergenic
992226086 5:74620787-74620809 ATGGGGAGCTGGAAAGAGGATGG + Intergenic
992474515 5:77088562-77088584 ATGGGGAGCTGGAAAGGGGGTGG + Intergenic
993036247 5:82760789-82760811 AAGGGGAGCTGGAAAGGGGATGG - Intergenic
993478711 5:88396684-88396706 TTGGTGTGGTTGAAAGAGGAAGG + Intergenic
993773542 5:91962501-91962523 GTGGGGAGCTGGAAAGGAGATGG - Intergenic
994533208 5:100992887-100992909 ATGGGGAGCTGGAAAGGGAATGG + Intergenic
994712319 5:103280811-103280833 GTGATCCGGTGGAAAGAGGAGGG + Intergenic
994762820 5:103878220-103878242 ATGGGAAGCTGGAAAGGGGATGG + Intergenic
994819290 5:104628132-104628154 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
994830424 5:104774897-104774919 AAGAGGAGCTGGAAAGAGGATGG + Intergenic
994998380 5:107094670-107094692 ATGGGGAGCTGGAAAAGGGATGG + Intergenic
994999029 5:107103482-107103504 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
995121131 5:108536202-108536224 ATGGAGAGCTGGAAAGAGGATGG - Intergenic
995494484 5:112726336-112726358 ATGGGGAGCTGGAAGGGGGATGG + Intronic
996242064 5:121215915-121215937 ATGGGGAGCTGGGAAGAGAATGG - Intergenic
996557884 5:124797655-124797677 AAGGGGAGCTGGAAAGCGGATGG - Intergenic
996576729 5:124983967-124983989 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
996580539 5:125027924-125027946 GTGGTGGGCTGAAGAGAGGTGGG + Intergenic
996890332 5:128411427-128411449 ATGGGGAGGTGGAAAGCGGACGG + Intronic
997318146 5:132955047-132955069 ATGGGGAGCTGGAAAAGGGATGG + Intronic
997663937 5:135612506-135612528 GTGGAGAGATGAAAAGAGGTGGG - Intergenic
998384647 5:141749784-141749806 GTGGTGAGGAGGACAGAGGCTGG + Intergenic
998535234 5:142924212-142924234 AAGGAGAGTTGGAAAGAGGAGGG - Intronic
998612459 5:143703812-143703834 ATAGGGAGCTGGAAAGCGGATGG + Intergenic
998791162 5:145767323-145767345 ATGGGGAGCTGGAAAGGGGATGG - Intronic
999431864 5:151531613-151531635 GTGGTCAGCGGGAACGAGCAAGG - Exonic
999668495 5:153937322-153937344 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1000234449 5:159344555-159344577 ATGGGGAGCTAGAAAGGGGATGG + Intergenic
1000742511 5:164987230-164987252 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1000852882 5:166362125-166362147 GTGGGGAGCTGGAAAGGGGATGG + Intergenic
1000949424 5:167462566-167462588 ATGGGGAGCTGGAAAGGGGATGG + Intronic
1001037179 5:168305585-168305607 GTGGTTTGCTGCTAAGAGGAAGG - Intronic
1001950176 5:175810980-175811002 GGGATGAGATGGAAAGAGCACGG + Intronic
1002096793 5:176836110-176836132 GCAGTGAGCTGGACAGAGAATGG + Intronic
1002345246 5:178544215-178544237 GTGGTGGGGTGGGAAGGGGAAGG - Intronic
1002762648 6:214046-214068 ATGGGGAGCTGGAAGGAGGAGGG - Intergenic
1002999749 6:2319826-2319848 GAGGGGAGCTGGAAAGAGGATGG + Intergenic
1003370707 6:5523296-5523318 GTGGTGAGCTGGGAAGGGTCAGG + Intronic
1003551306 6:7104494-7104516 GGGGAGAGGTGGAAAGAGGAGGG + Intergenic
1003604824 6:7549768-7549790 AGGGAGAGATGGAAAGAGGAAGG + Intronic
1004233330 6:13852048-13852070 GTGGAGGGCAGGGAAGAGGAGGG - Intergenic
1004321933 6:14638735-14638757 GTGGGGAGCAGAAAAGAGGAAGG - Intergenic
1004546002 6:16598907-16598929 GTGTCCAGCTGAAAAGAGGAGGG + Intronic
1004906123 6:20238802-20238824 AAGGGGAGCTGGAAAGAGGGTGG + Intergenic
1005200883 6:23342791-23342813 TTGGGGGGCTGGAAAGGGGATGG - Intergenic
1005321122 6:24655470-24655492 GTGCTGAGCTAAGAAGAGGAGGG + Intronic
1005342671 6:24858043-24858065 GAGAGGAGCAGGAAAGAGGAAGG - Intronic
1005814428 6:29539190-29539212 GAGGTGAGCAGGAGAGAGGTTGG - Intergenic
1005922980 6:30417332-30417354 GTGGGAACCTGGAAAGAGCATGG - Intergenic
1005972748 6:30774322-30774344 GTCGGGGGCAGGAAAGAGGATGG + Intergenic
1006060139 6:31413143-31413165 GTGGGAACCTGGAAAGAGTAGGG - Intronic
1006409578 6:33864786-33864808 GAGGGGAGCTGGAGAGGGGATGG - Intergenic
1006637849 6:35473429-35473451 GTGCTCAGCTGGAAGCAGGAGGG + Intergenic
1007303273 6:40884733-40884755 TTGGGGAGCTGGAGAGGGGATGG + Intergenic
1007306078 6:40906210-40906232 GTGGAGAGTTGGGGAGAGGAAGG - Intergenic
1007373462 6:41441826-41441848 GCGGTAAGAGGGAAAGAGGAGGG + Intergenic
1008619507 6:53258149-53258171 GTGGTGAGCAAGGAAGAGGATGG + Intergenic
1009001666 6:57724310-57724332 ATGGGGAGTTGGAAAGGGGATGG - Intergenic
1009524671 6:64728891-64728913 GAGGGGAGCTGGAAAGCAGATGG + Intronic
1009790394 6:68394221-68394243 GTAGTGGGGTGGAAAGAGGGTGG - Intergenic
1010294719 6:74182711-74182733 GAGGGGAGCTGGAGAGGGGATGG - Intergenic
1010494222 6:76513818-76513840 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1011261696 6:85476696-85476718 ATGGGGAGCTGGAAAGGGGATGG + Intronic
1011353328 6:86446890-86446912 ATGAGGAGCTGGAAAGGGGATGG + Intergenic
1011716511 6:90111239-90111261 GTGGTGGCCTGGACAGAAGATGG - Intronic
1012263242 6:97111808-97111830 AAGGGGAGCTGGAAAGGGGATGG + Intronic
1012743694 6:103055046-103055068 ATGGGGAGGTGGAAAGCGGATGG + Intergenic
1012769039 6:103405280-103405302 AAGGAGAGCTGGAAAGGGGATGG + Intergenic
1012945458 6:105461162-105461184 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1013034241 6:106364640-106364662 GTGGTGTGGTGGAATGAGCATGG + Intergenic
1013164388 6:107576616-107576638 GTGGTGAGCTGGGAATGGTATGG + Intronic
1013216550 6:108032636-108032658 GAGGGGAGCTGGAGAGGGGATGG + Intergenic
1013338047 6:109185423-109185445 GTGATGAGATGGAAAGATCATGG + Intergenic
1013826063 6:114213095-114213117 ATGGAGAGCTAGAAAGGGGATGG + Intronic
1013945125 6:115713883-115713905 GCTGTGAGCTGGAAAGAGCTGGG - Intergenic
1014107403 6:117582662-117582684 GAGGGGAGCTGGAAAGGGGATGG - Intronic
1014635628 6:123843317-123843339 ATGGGGAGCTGGAAAGGGGATGG + Intronic
1014740511 6:125143451-125143473 GAGGGGAGCTGGAGAGGGGATGG + Intronic
1014775334 6:125502689-125502711 GTGTTAAGCTGGAAAAAGCATGG + Intergenic
1014812412 6:125901851-125901873 ATGGGGAGCTGGAAAGGAGATGG + Intronic
1014825803 6:126047448-126047470 ATGGGGAGCTGTAAAGGGGATGG - Intergenic
1014912473 6:127111396-127111418 GGGGAGAGCTGGAAAGCAGAAGG + Intergenic
1015288549 6:131511435-131511457 ATGGGGAGCTAGAAAGGGGATGG - Intergenic
1015389699 6:132667762-132667784 GGGATGAACAGGAAAGAGGAAGG - Intergenic
1016532797 6:145076540-145076562 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1016695090 6:146984807-146984829 CTGGTGAGCTGGGTAGAGGTTGG - Intergenic
1017209588 6:151840330-151840352 GTGGTGAAATGGAAAGAGATGGG + Intronic
1017584856 6:155909394-155909416 AAGGGTAGCTGGAAAGAGGATGG - Intergenic
1017628339 6:156370715-156370737 GTGGTGTGCTGGTGAAAGGAGGG - Intergenic
1017633611 6:156422844-156422866 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1017758597 6:157550835-157550857 GTGTTGAGCTGGCACGATGATGG + Intronic
1017782359 6:157725794-157725816 ATGGGGAGTTGGAAAGGGGATGG - Intronic
1017804008 6:157927113-157927135 ATGGAAAACTGGAAAGAGGAAGG + Exonic
1017960422 6:159216598-159216620 TTGGTGAGTTGGAAGGAGCATGG + Intronic
1018201437 6:161399168-161399190 ATGGGGAGCTGGAAAGGGGATGG - Intronic
1018278016 6:162153680-162153702 AGGGGGAGCTGGAAAGGGGATGG + Intronic
1018754873 6:166840358-166840380 GTGGGGAGGTAGAGAGAGGAAGG - Intronic
1019012344 6:168851723-168851745 CTGTTGAGCTGTGAAGAGGATGG - Intergenic
1019268641 7:133745-133767 GTGGTGGGCTGGACAGCAGAAGG + Intergenic
1019608248 7:1921012-1921034 GTGGGGAGGTGGGAAGAGGGCGG + Intronic
1019983878 7:4641557-4641579 GTGGTGACCTGGATGGAGGGCGG - Intergenic
1020061000 7:5152201-5152223 GTGGAGACCTGGAAGCAGGATGG - Intergenic
1020167107 7:5816197-5816219 GTGGAGACGTGGAAACAGGATGG + Intergenic
1020389881 7:7646671-7646693 ATGGGGAGCTGGAGAGGGGATGG + Intronic
1020926151 7:14327730-14327752 GTGGTGAGCTGGCCAGAGTGAGG + Intronic
1021041910 7:15872800-15872822 ATGGGGAGCTGGACAGAGGATGG - Intergenic
1021510139 7:21426180-21426202 TTGGTGAACTGGGAGGAGGAGGG + Intergenic
1021560501 7:21964749-21964771 ATGGAGAGCTGGAAGGGGGATGG - Intergenic
1021626595 7:22599539-22599561 GTGGAGATCTGGAAAGTGGGTGG + Intronic
1021645945 7:22789592-22789614 GAGGAGAGTTGGAAAGGGGACGG + Intergenic
1021813317 7:24424556-24424578 GTGGTGATCATGGAAGAGGAGGG + Intergenic
1022047672 7:26635605-26635627 GGGGTGAGTGGGAAAGGGGAGGG + Intergenic
1023086702 7:36577402-36577424 GGGGTGAGCTGGAAGGAGCCTGG + Intronic
1023367175 7:39475508-39475530 GTGCTGAGAAGGGAAGAGGAAGG + Intronic
1023754335 7:43402064-43402086 GTGGTGAGCTGGAAAGAGGATGG - Intronic
1024146411 7:46521982-46522004 GTGGTGACCTGAACAGAGGGTGG + Intergenic
1024266597 7:47611516-47611538 GTGGTTAGATGGAAAGGGCAAGG + Intergenic
1025252511 7:57361194-57361216 GAGCTGAACTGAAAAGAGGATGG + Intergenic
1026281015 7:68921806-68921828 AAGGGGAGCTGGAAAGGGGATGG - Intergenic
1026918704 7:74139418-74139440 GAGGGGAGCTGGAGAGGGGATGG - Intergenic
1027333460 7:77123273-77123295 ATGGTGCGGTGGAAAGAGCAGGG + Intronic
1027706143 7:81535912-81535934 ATGGGGAGCAGGAAAGGGGATGG - Intergenic
1027708518 7:81567163-81567185 ATGGGGAGCGGGAAAGGGGATGG - Intergenic
1027840172 7:83299559-83299581 GTGGAGAGTTGGAAAGATGTTGG - Intergenic
1028128889 7:87147238-87147260 GTGGTGGGCTGGAGTGAGGCAGG - Intergenic
1028531394 7:91842372-91842394 AAGGGGAGCTGGAAAGGGGATGG - Intronic
1028761112 7:94497349-94497371 ATAGGGAGCTGGAAAGGGGATGG + Intergenic
1028872287 7:95782799-95782821 ATGGGGAGCTGGAAAGGGGATGG + Intronic
1029016118 7:97316772-97316794 ACGGGGAGCTGGAAAGGGGATGG - Intergenic
1029017277 7:97327507-97327529 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1029578307 7:101418845-101418867 GTGGAGAGGAGGAAAGAGGAAGG - Intronic
1029782335 7:102748038-102748060 ATGGTGCGGTGGAAAGAGCAGGG - Intergenic
1030170565 7:106598773-106598795 GTGGGGAGCTGGAAGGAGCCAGG - Intergenic
1030386553 7:108874216-108874238 ATGGGGAGCTGTAAAGGGGATGG - Intergenic
1030387166 7:108878209-108878231 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1031467723 7:122134178-122134200 GAGATGAACTGGAAAGAGGTTGG - Intronic
1031693444 7:124818730-124818752 GTGGGGAACTGGAAGGGGGATGG - Intergenic
1031712651 7:125068270-125068292 GTGGGGAGCTGGAAAGGGGATGG + Intergenic
1031974095 7:128083006-128083028 GTGGTGGGCTCCAGAGAGGAAGG + Intronic
1032612475 7:133430144-133430166 ATGGGGAGCTGGAAAGGAGATGG + Intronic
1033240402 7:139674460-139674482 GTGCTGAGCCTGAAAGAGCAAGG + Intronic
1033653872 7:143361193-143361215 GTGGTGAACCGGACTGAGGAGGG + Intronic
1033767093 7:144505844-144505866 ATGGGGAGCTGGAAAGGGGATGG - Intronic
1033820070 7:145124477-145124499 GTAGTGAGCAGGAAATATGAAGG - Intergenic
1033840237 7:145364400-145364422 GTGGTGAGGAGTAAAGAGGGAGG + Intergenic
1033881302 7:145887155-145887177 ATGGTGAGCTAGAAAGGGGATGG + Intergenic
1033976046 7:147101647-147101669 ATGGGGAGCTGGAAAGGAGATGG + Intronic
1034276683 7:149826841-149826863 GTGGGGAGCAGGGATGAGGAAGG + Intergenic
1034400865 7:150860669-150860691 GGGCTGAGCTGGAAGGAGGCAGG - Intronic
1035370346 7:158375868-158375890 ATGGGGAGCTGGAGAGGGGATGG - Intronic
1035824397 8:2629083-2629105 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1036051093 8:5197701-5197723 GTGGTGGGGTGGAGGGAGGACGG + Intergenic
1036574675 8:10015528-10015550 GTAGTGAGAGTGAAAGAGGAAGG - Intergenic
1036584793 8:10113411-10113433 GGGGTTAGCCTGAAAGAGGAGGG + Intronic
1038087691 8:24218029-24218051 GTGGAGAGATGGAAGGAGGAAGG + Intergenic
1038492906 8:27982825-27982847 CAGGTGAGATGGGAAGAGGAGGG - Intronic
1038896888 8:31793882-31793904 ATGGAGAGATGGAAGGAGGAAGG - Intronic
1039103977 8:33970609-33970631 ATGGGGAGCTGGAGAGGGGATGG + Intergenic
1039290443 8:36088867-36088889 ATGGGGAGCTAGAAAGGGGATGG + Intergenic
1039306334 8:36267336-36267358 ATGAGGAGCTGGAAAGGGGATGG + Intergenic
1039918185 8:41875086-41875108 GAGCTGAGCTGGAAAGGGTACGG + Intronic
1040835036 8:51722587-51722609 ATAGGGAGCTGGAAAGGGGATGG + Intronic
1041131959 8:54710664-54710686 GAGGGGAGCTGGAAAAAGGATGG + Intergenic
1041201979 8:55458624-55458646 ATGGGGAGCTGGAAAGGGAATGG + Intronic
1041216667 8:55607844-55607866 GTGGGGAGCTGGAAAGCGGATGG - Intergenic
1042163690 8:65923902-65923924 GTTTTGAGCTGGGCAGAGGAAGG + Intergenic
1042238696 8:66640780-66640802 GTGGGGAGCTGGAAAGGGGATGG - Intronic
1042333659 8:67608466-67608488 ATGGGGAGCTGGAAAGTGAACGG - Intronic
1042790771 8:72603287-72603309 GGGGTGAGCTGGGAAGGGAATGG - Intronic
1042978486 8:74498817-74498839 GTGGGGAGCAGGACAGAGAAAGG - Intergenic
1042984371 8:74566688-74566710 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
1043052080 8:75396739-75396761 GTGGTGAGAAGGAAAGAGGAGGG - Intergenic
1043220454 8:77655814-77655836 TTGGGGAGCTGGAAAGGGGATGG - Intergenic
1043999786 8:86865442-86865464 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1044273469 8:90273680-90273702 ATGGTTAGCTGGAAAGATCAAGG - Intergenic
1044274660 8:90285681-90285703 ATGGGGAGCTGAAAAGGGGATGG + Intergenic
1044778711 8:95721556-95721578 GTGGTGAGTGAGAAAGAGAAGGG + Intergenic
1044896608 8:96899131-96899153 GTGCTGAGATGGAAAAAGAAAGG + Intronic
1045069700 8:98489051-98489073 GTGGTGAGCTGGAAGGAGTGGGG + Intronic
1046582522 8:116110870-116110892 ATGGGGAGCTAGAAAGGGGATGG - Intergenic
1046607020 8:116382568-116382590 GAGGAGAGAGGGAAAGAGGATGG - Intergenic
1047113788 8:121818524-121818546 ATGGGGAGCAGGAAAGGGGATGG - Intergenic
1047597720 8:126395464-126395486 GTAGTGAGCTGGGAAGATGAGGG - Intergenic
1047679868 8:127243504-127243526 GGGGTGAGCTGGAACTTGGATGG + Intergenic
1048074990 8:131060505-131060527 ATGGAGAGCTAGACAGAGGATGG - Intergenic
1048616084 8:136076887-136076909 GAGGGGAGGTGGAAAGGGGATGG + Intergenic
1048641695 8:136370245-136370267 GAGGGGAGCTGAAAAGGGGATGG + Intergenic
1048680101 8:136831855-136831877 ATGAGGAGCTGGAAAGGGGATGG + Intergenic
1048706456 8:137158939-137158961 GTGGTAAACTGGAGAGAAGAAGG + Intergenic
1048872950 8:138813796-138813818 CTGGTGACCTGGAGAGAGGATGG - Intronic
1048900364 8:139031737-139031759 ATGGGGAGCTGGAAAGGGGAAGG + Intergenic
1049309835 8:141927995-141928017 GGGCTGAGCTGGACTGAGGACGG - Intergenic
1049371963 8:142272265-142272287 GTGGCTAGGTGGAAGGAGGAAGG - Intronic
1049371983 8:142272337-142272359 GTGGGTGGATGGAAAGAGGAAGG - Intronic
1049888061 9:41543-41565 CAGGAGAGCTGGACAGAGGAAGG - Intergenic
1050266865 9:3900126-3900148 GTGGGGAGGTGGAAATGGGAAGG + Intronic
1050330427 9:4540242-4540264 GAGGGGAGCTGAAAAGGGGATGG - Intronic
1050939707 9:11443332-11443354 GAGGGGAGCTGGAGAGAGGATGG - Intergenic
1051263471 9:15288534-15288556 ATGGGGAGCTGGAAGGGGGATGG - Intronic
1051631641 9:19146245-19146267 GTGGAGAGCTGGCAAGAACATGG - Intronic
1051983800 9:23057633-23057655 ATGAGGAGCAGGAAAGAGGATGG - Intergenic
1052289305 9:26823931-26823953 GTGGGGAGCTGGAACAGGGATGG + Intergenic
1052793653 9:32902287-32902309 GTGGGGAGCTAGAAGGGGGATGG - Intergenic
1052820169 9:33132213-33132235 GTTGTGAAGTGGGAAGAGGAGGG + Intronic
1052961241 9:34298862-34298884 GTGGGGAGCTGGGGAGAGAAAGG + Intronic
1053303302 9:36966727-36966749 TTGATGAGCAGGAGAGAGGAAGG + Intronic
1053357071 9:37455321-37455343 ATGGGGAGCTGGAAAGGGGATGG - Intronic
1053508702 9:38668833-38668855 GTGGTCAAATGGAAAGAGCATGG + Intergenic
1053608690 9:39687285-39687307 GTGATAAGCAGAAAAGAGGAAGG - Intergenic
1054244834 9:62655125-62655147 GTGATAAGCAGAAAAGAGGAAGG + Intergenic
1054353444 9:64040613-64040635 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1054558960 9:66689656-66689678 GTGATAAGCAGAAAAGAGGAAGG + Intergenic
1055033892 9:71797439-71797461 ATGAAGAGATGGAAAGAGGAAGG - Intronic
1055121382 9:72664694-72664716 GTGGGGAGCTGGAAAGGGGATGG - Intronic
1055449277 9:76416268-76416290 ATGGGCAGCTGGAAAGGGGATGG - Intergenic
1055486281 9:76759605-76759627 ATGGGGAGCTGGAAAGGGAATGG - Intronic
1055592516 9:77832428-77832450 GTGGTGCACTTGGAAGAGGATGG + Intronic
1055708467 9:79033671-79033693 GTGGGGAGCTAGAGAGGGGATGG + Intergenic
1055869337 9:80855336-80855358 ATGGGGAGCCGGAAAGGGGATGG + Intergenic
1056072975 9:83007968-83007990 AGTGTGAGATGGAAAGAGGAAGG - Intronic
1056085729 9:83147814-83147836 AGGGGGAGCTGGAAAGGGGATGG + Intergenic
1057569199 9:96190980-96191002 TTGGTGAGTTGGAGAGAGGAAGG - Intergenic
1057830936 9:98406463-98406485 CTGGGGTGCTGGAAAGATGACGG + Intronic
1058317458 9:103586525-103586547 GAGGGGAGCTGGAGAGGGGATGG - Intergenic
1058321432 9:103636360-103636382 ATGGGGAGCTGGAAAAGGGATGG - Intergenic
1058424839 9:104867223-104867245 GTGGGGAACAGGAGAGAGGAAGG + Intronic
1058828033 9:108792601-108792623 GAAGGGAGCTGGAAAGGGGATGG - Intergenic
1059062225 9:111045355-111045377 AAGGGGAGCTGGAAAGGGGATGG - Intergenic
1059111170 9:111559558-111559580 CTGGTGAGCAGGAAGAAGGAGGG - Intronic
1059556100 9:115282002-115282024 GAGGTGAGCTGGGCAGAGAAAGG + Intronic
1059573808 9:115468545-115468567 ATAGGGAGCTGGAAAGGGGATGG + Intergenic
1059647560 9:116282419-116282441 ATGGTGAGATGGAAAAAGGGTGG - Intronic
1061386477 9:130293570-130293592 GGTGTGAGCTGGGGAGAGGAGGG + Intronic
1061490601 9:130941905-130941927 TTGGTGAGCCAGAAAGAGGAAGG - Intergenic
1061559909 9:131395152-131395174 GTGGTGAGCTTGAAGGAAGTGGG + Intronic
1061650255 9:132042074-132042096 GTGGCGGGGTGGAAAGAGCACGG + Intronic
1061737803 9:132674228-132674250 GTGGTCAACTGGAAACTGGATGG + Intronic
1062288847 9:135785694-135785716 GTGGGGTGCTGGGAAGAGGTAGG - Intronic
1062372969 9:136249535-136249557 CTGGGGAGCTGGGAAAAGGACGG + Intergenic
1203695907 Un_GL000214v1:96717-96739 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1203741777 Un_GL000218v1:9723-9745 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1203701966 Un_KI270742v1:4313-4335 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1203553949 Un_KI270743v1:190368-190390 ATGGGAAGCTGGAAAGGGGATGG + Intergenic
1203640366 Un_KI270751v1:7346-7368 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1185738502 X:2511776-2511798 ATGGGGAGCTGGAAAGGGAATGG + Intergenic
1185769787 X:2757073-2757095 TTGGGGAGTTGGAAAGGGGATGG + Intronic
1185796716 X:2971851-2971873 ATGGGGAGTTGGAAAGGGGACGG + Intergenic
1185961786 X:4552611-4552633 ATGAGGAGCTGGAAAGCGGATGG + Intergenic
1186036474 X:5428882-5428904 ATGGGGAGCCGGAAAGGGGATGG + Intergenic
1186056473 X:5654707-5654729 ATGGGGAGCTGGAGAGGGGATGG + Intergenic
1188437561 X:30179662-30179684 ATGGGGAGCTTGAAAGGGGATGG - Intergenic
1188526567 X:31094106-31094128 ATGGGGAGCTGGAAAGGAGATGG + Intergenic
1188624761 X:32269624-32269646 ATGGTGAGCCGGAATGAGTAAGG - Intronic
1189375337 X:40462086-40462108 GTGGTGAGATGGCTACAGGATGG - Intergenic
1189450303 X:41122804-41122826 ATGGGGAGCTGGAGAGGGGATGG + Intronic
1189597426 X:42584206-42584228 GTGGTGGGTTAGAAAGAGGTTGG + Intergenic
1190154090 X:47973655-47973677 GTGGTGAACAGGGAAGAGTAGGG - Intronic
1190167507 X:48085272-48085294 AAAGGGAGCTGGAAAGAGGAAGG + Intergenic
1190569375 X:51766173-51766195 CTGGGGAGCTGGAAAGGGGATGG - Intergenic
1190873688 X:54445170-54445192 GTGGTGAGCTTGGAAGAGCTGGG + Exonic
1191091389 X:56626274-56626296 GTGGGGAGAAGAAAAGAGGAGGG + Intergenic
1192332286 X:70185663-70185685 GTTGGGAACTGGAAAGGGGAGGG - Intronic
1192430337 X:71107457-71107479 GAGGGTAGATGGAAAGAGGAAGG + Exonic
1192590470 X:72355420-72355442 GTGCTGAGGGGGAAAGGGGAAGG - Intronic
1192816104 X:74594267-74594289 GTGGGGAGGTGGATAGACGATGG - Intronic
1193111115 X:77731798-77731820 GAGGGGAGCTGGAGAGGGGATGG - Intronic
1193486087 X:82086746-82086768 GAGGGGAGCTGAAGAGAGGATGG + Intergenic
1193709374 X:84860770-84860792 ATGGAGAGCTGGAAAGGGGATGG - Intergenic
1194119463 X:89942998-89943020 ATGGGGAGCTGGAAGGTGGAGGG - Intergenic
1194278007 X:91911603-91911625 GTGGTAAGTTGGGGAGAGGAGGG - Intronic
1194763076 X:97816994-97817016 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1194979173 X:100423028-100423050 GTGGGGAGCTAGAAAGGGAATGG + Intergenic
1195210840 X:102651539-102651561 GAGGAGAGCTGAAGAGAGGAGGG + Exonic
1195647558 X:107249751-107249773 CTGGGGAGCTGAAAAGGGGATGG + Intergenic
1196108773 X:111924017-111924039 TTGCTGTCCTGGAAAGAGGATGG + Intronic
1196861564 X:120033664-120033686 ATGGGGAGCTGGAAAGGGAATGG - Intergenic
1197340695 X:125263314-125263336 ATGGGGAGCTGTAAAGGGGATGG + Intergenic
1197799141 X:130330849-130330871 GTGGCGTGCTGGAGAGAGCAAGG + Intergenic
1197814425 X:130482135-130482157 GTAGTGAGCTGGGAAGAGCATGG - Intergenic
1197923704 X:131624290-131624312 GTGGGAAGCAGCAAAGAGGACGG - Intergenic
1197969187 X:132097119-132097141 GTGAGGATCTGGAGAGAGGATGG - Intronic
1197976761 X:132173855-132173877 CTGGTCAGCAGGAATGAGGAAGG + Intergenic
1197997395 X:132392739-132392761 ATGGTGAAGAGGAAAGAGGAAGG - Intronic
1198147034 X:133867950-133867972 ACGGGGAGCTGGAAAGGGGATGG - Intronic
1198363419 X:135917509-135917531 GAGGGGAGCTGGAAAGCGTATGG + Intergenic
1198434590 X:136603833-136603855 ATGGTGAGGTGGACAGAGGAGGG - Intergenic
1198454583 X:136803873-136803895 GAGGAGAGCTGGAAAGGGAATGG + Intergenic
1198465683 X:136902744-136902766 GAAGTGAACTGGAAAGAGGATGG + Intergenic
1198557908 X:137815604-137815626 GTGGTTATCTGGAGATAGGAAGG + Intergenic
1198675564 X:139126907-139126929 GTGGTGAGCTGAAATGAAGGAGG - Intronic
1199226744 X:145384868-145384890 GGGGTGAGAAGAAAAGAGGAAGG - Intergenic
1199380654 X:147168475-147168497 ATGGGGAGCTGGAAAGGAGATGG - Intergenic
1199575688 X:149311748-149311770 ATGGGGAACTGGAAAGGGGATGG + Intergenic
1199676636 X:150195102-150195124 GTGTGGAGCAGGAAAAAGGAGGG + Intergenic
1199818770 X:151424015-151424037 TGGCTGATCTGGAAAGAGGAGGG - Intergenic
1199995397 X:153021598-153021620 GTGGTGAACAGGAGGGAGGAGGG - Intergenic
1200093094 X:153644804-153644826 GAGCTGGGCTGGAATGAGGACGG - Intronic
1200248854 X:154541675-154541697 GTGGTCCTCAGGAAAGAGGAGGG - Intronic
1200472336 Y:3600555-3600577 ATGGGGAGCTGGAAGGTGGAGGG - Intergenic
1200595344 Y:5133676-5133698 GTGGTAAGTTGGGGAGAGGAGGG - Intronic
1200695744 Y:6357393-6357415 GTGGTGAGTTTGGAACAGGAAGG + Intergenic
1201039534 Y:9817317-9817339 GTGGTGAGTTTGGAACAGGAAGG - Intergenic
1201155309 Y:11127177-11127199 ATGGGGAGCTGGAAAGGGGATGG + Intergenic
1201300732 Y:12502559-12502581 TTGGGGAGCTGGAAAGGGGATGG - Intergenic
1201547716 Y:15184253-15184275 ATGGGTAGCTGGAAAGGGGATGG - Intergenic
1201634301 Y:16105092-16105114 ATGGGGAGCTGGAAAGGGGATGG - Intergenic
1201751498 Y:17436650-17436672 ATGGGGAGATGGAAAGGGGATGG + Intergenic
1202174284 Y:22083502-22083524 GTAATGAGCAGGAAAGATGAGGG + Intronic
1202217076 Y:22502880-22502902 GTAATGAGCAGGAAAGATGAGGG - Intronic
1202326109 Y:23693190-23693212 GTAATGAGCAGGAAAGATGAGGG + Intergenic
1202544662 Y:25976864-25976886 GTAATGAGCAGGAAAGATGAGGG - Intergenic