ID: 1023758072

View in Genome Browser
Species Human (GRCh38)
Location 7:43438782-43438804
Sequence ATGTATTTCTTTAGGTAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 439
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 413}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023758067_1023758072 1 Left 1023758067 7:43438758-43438780 CCAGATAACAGCCCTATGTATAA 0: 1
1: 0
2: 0
3: 13
4: 105
Right 1023758072 7:43438782-43438804 ATGTATTTCTTTAGGTAACAGGG 0: 1
1: 0
2: 2
3: 23
4: 413
1023758068_1023758072 -10 Left 1023758068 7:43438769-43438791 CCCTATGTATAATATGTATTTCT 0: 1
1: 0
2: 9
3: 84
4: 780
Right 1023758072 7:43438782-43438804 ATGTATTTCTTTAGGTAACAGGG 0: 1
1: 0
2: 2
3: 23
4: 413

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023758072 Original CRISPR ATGTATTTCTTTAGGTAACA GGG Intronic
905351984 1:37353657-37353679 ATGTATTTCCAAATGTAACATGG + Intergenic
906161735 1:43654750-43654772 TTGTTTTACTTTATGTAACAAGG - Intronic
906769171 1:48468962-48468984 ATGTATTTATTTAAGAGACAGGG + Intronic
907691682 1:56673419-56673441 TTTTATTTCTTTAGAGAACATGG - Intronic
908527706 1:65003227-65003249 TTGTATTTCTTCGGGTAACTGGG + Intergenic
908569058 1:65389636-65389658 AAGTGTTTCTTTAAGTCACATGG + Intronic
911517358 1:98882715-98882737 ATGTATTTGTTTAAGAAATAGGG + Intergenic
911726678 1:101248716-101248738 ATGTATTTATTAAGGAGACAGGG + Intergenic
912282485 1:108330496-108330518 ATGTCTTCCTTTTAGTAACAGGG - Intergenic
912677977 1:111703595-111703617 ATTTTTTTCTTTTGGTCACAGGG - Intronic
913501828 1:119478840-119478862 ATGTAATTCTTAAGATATCAGGG + Intergenic
914215454 1:145623660-145623682 ATGTATTTCTTCTGGAAACTAGG + Exonic
914467404 1:147944044-147944066 ATGTATTTCTTCTGGAAACTAGG + Exonic
915350901 1:155225079-155225101 ATTTATTTTTTTAGGTGACAGGG - Intergenic
915443156 1:155959141-155959163 GTGTATTTTTTTGGGTGACAGGG + Intronic
915870429 1:159554320-159554342 AGGTATTTATATATGTAACAGGG - Intergenic
916007404 1:160674980-160675002 ATGGCTTTCTTTAAGGAACAGGG - Intergenic
916329280 1:163596168-163596190 ATGTATACCTGTAGGTCACAAGG - Intergenic
916680841 1:167103799-167103821 CTGTATTTGTTTAGGTGACTGGG - Intronic
916957229 1:169851309-169851331 ATATATTTTTTTAGGTGAAATGG + Intronic
917694901 1:177512466-177512488 ATGTTTGTGTTTAGGTAACTCGG + Intergenic
918306928 1:183255494-183255516 TTATATTTCTTTAGGTAGCATGG + Intronic
918598386 1:186321011-186321033 ATTAATGTCTTTAGGAAACATGG + Intronic
919841584 1:201613244-201613266 ATGTATTTATTTTGGAAACTTGG + Intergenic
922047260 1:221958201-221958223 ATGTATATGTGTAGGTCACAGGG - Intergenic
923365316 1:233254513-233254535 ATGTATTTTTTAAGGAAAAAAGG - Intronic
923665704 1:235996748-235996770 ATGTATTTTTTTAAGTGGCAGGG + Intronic
924957313 1:248942043-248942065 ATGTATATCTTATGGTTACATGG + Intergenic
1064871574 10:19943668-19943690 AAGTATTTCTTTAGGGTACAAGG - Intronic
1064992960 10:21272580-21272602 ATGTATTTATTTATTTGACATGG - Intergenic
1065345413 10:24743520-24743542 ATGTATATCTTTATAAAACAAGG + Intergenic
1068162943 10:53290892-53290914 ACTTATTTTTTTAAGTAACAAGG - Intergenic
1068462591 10:57346999-57347021 ATGTATTGCTTTGGGTAGTATGG + Intergenic
1068964863 10:62901866-62901888 AGTTCTTTCTTTAGGTAAAAAGG - Intronic
1069284459 10:66695341-66695363 ATTTGTTTCTTTGGGCAACATGG + Intronic
1070451504 10:76562493-76562515 ATGCATTTTTCTATGTAACATGG - Intergenic
1072080483 10:92025104-92025126 ATGTAGTTCTATAGTTAAAAAGG - Intronic
1072182308 10:92998097-92998119 TTATTTTTTTTTAGGTAACAAGG + Intronic
1072834390 10:98695592-98695614 ATGTACTTCTCTAGGCAATAGGG - Intronic
1073313338 10:102560114-102560136 AAGTATTTCTTTTGTAAACAGGG - Intronic
1074344672 10:112672325-112672347 TTTTCTTTCTTTTGGTAACATGG - Intronic
1076963216 10:133783887-133783909 ATGTATATCTTATGGTTACATGG + Intergenic
1079139953 11:17801963-17801985 ATGTGTTTTTTTATGAAACAGGG - Intronic
1079896347 11:26123847-26123869 ATGAATTTCTCTAAGAAACAGGG + Intergenic
1080454976 11:32410101-32410123 TTGTATTTCTGTAGAGAACAGGG + Intronic
1081441877 11:43089774-43089796 ATGACTTTCTTTGGCTAACAGGG + Intergenic
1082112334 11:48291155-48291177 AGGTATTTTTTGAGGTAAAAAGG + Intergenic
1082805971 11:57450683-57450705 ATTTATTTCTTTTAGAAACATGG - Intergenic
1084343719 11:68528368-68528390 ATATATTTCTTTAGAGAAGAGGG - Intronic
1084622807 11:70285009-70285031 ATGTATTTCTTTATTTAAGATGG + Intronic
1085148823 11:74231062-74231084 ATTTATTTATTTAGGAGACAAGG + Intronic
1087510730 11:99089656-99089678 ATGTATTTCTAATGATAACATGG - Intronic
1088266997 11:107997440-107997462 ATTTATTTATTTTGGAAACAGGG + Intergenic
1089766244 11:120768127-120768149 ATGTATTGCTTTGGGTAGTATGG + Intronic
1090116069 11:123975645-123975667 AGGTATTTCTATAGATGACAAGG + Intergenic
1091346140 11:134855480-134855502 ATGGATTTCTTTTGGTAAAAAGG + Intergenic
1091483276 12:856798-856820 ATTTATGTGTTTAGGGAACAAGG + Intronic
1092069613 12:5622052-5622074 ACTTATTTTTTTAGGTGACATGG - Intronic
1093587541 12:20858746-20858768 ATGTATTTCTTTATTTATCATGG + Intronic
1094433251 12:30393624-30393646 ATGTTTTCCTTTAGGTAATGAGG + Intergenic
1094678146 12:32642068-32642090 AGATATTTCTTAAAGTAACAAGG - Exonic
1095823611 12:46508096-46508118 ATGTAGTCCTCTAGGTATCAGGG + Intergenic
1096234906 12:49919764-49919786 ATGTATTTGTTGAGGAAACCAGG + Intergenic
1096436846 12:51598895-51598917 ATGTATTTCTTAAGGAAAAGGGG - Intronic
1097329833 12:58320887-58320909 TTGTATTTTTTTAGTAAACATGG - Intergenic
1098094468 12:66939724-66939746 ATGGAGTTCTCTAGGTATCAAGG + Intergenic
1099210294 12:79778063-79778085 AATTATTTCTATAGGTAATATGG + Intronic
1099506913 12:83489484-83489506 ATGTAATTCTTTAAGGAAGAGGG - Intergenic
1099755245 12:86838219-86838241 TTGTATTTATTTTGGTATCATGG - Intronic
1101536860 12:105626163-105626185 ATTTATTTCTTCAGTTACCAAGG - Intergenic
1101666348 12:106819201-106819223 ATGTGTTTCTTTAAGCCACAAGG + Intronic
1102777620 12:115534321-115534343 ATCTATTTCTTTAAGAAATAAGG - Intergenic
1103134627 12:118497119-118497141 ATGTATCTGGTTAGCTAACATGG + Intergenic
1103877270 12:124137941-124137963 ATCTAGTTCTTTAGGTAAGAAGG - Intronic
1105436462 13:20382795-20382817 ATGTATAGCTTTTGGTAATATGG + Intergenic
1106501588 13:30334503-30334525 ATGTATTTGTTGAGGAAACTGGG + Intergenic
1106994503 13:35465847-35465869 AGGTAATTCTTTATGTTACAAGG - Intronic
1107367795 13:39703755-39703777 ATTTATTTTTTTAAGCAACAGGG + Intronic
1107726218 13:43302365-43302387 ATGTATTTATTAAGAAAACATGG + Intronic
1107850836 13:44571785-44571807 ATACATTTGGTTAGGTAACAAGG + Intronic
1108328331 13:49357803-49357825 ATGTCATTCTGTAGGCAACATGG - Intronic
1108561455 13:51648186-51648208 CAGTATTTCTTTAGGAAATAAGG + Intronic
1108789652 13:53952256-53952278 ATGTATTTCTAGAGGAAAAATGG - Intergenic
1108945983 13:56024469-56024491 ATGTGTTTCTTTAAGTAAATGGG + Intergenic
1109065933 13:57690629-57690651 ATGAATTTCATTAGGTGAAATGG + Intronic
1109321822 13:60819229-60819251 ATGTTGTTCTTTGGGTCACAAGG + Intergenic
1110143301 13:72157985-72158007 ATGCATTTCTTGAGATGACATGG + Intergenic
1110163968 13:72414663-72414685 ATGAATTACTTTATGTGACATGG + Intergenic
1110239355 13:73249723-73249745 TTCTATTTCTTTAGCTATCATGG + Intergenic
1110801085 13:79695885-79695907 ATGTATATGTTTAGGGAAGAAGG + Intergenic
1110918903 13:81059567-81059589 TTGTATTTTTATAGATAACACGG + Intergenic
1111179737 13:84648301-84648323 ATGTAGTTTTTTTGTTAACATGG + Intergenic
1111400511 13:87728202-87728224 ATGTATTTCCTTTGGTGATATGG - Intergenic
1112120316 13:96403128-96403150 AAGTACATCTTTAGTTAACAGGG - Intronic
1112193492 13:97201225-97201247 ATGTGTTTCTAAAGGTAAGATGG - Intergenic
1112693623 13:101922211-101922233 AAGGATCTCTTTAGGTACCATGG - Intronic
1113214235 13:108019632-108019654 ATGATTTTATTTAGGTAACATGG - Intergenic
1113417189 13:110137450-110137472 TTGAATTTCTTTAAGTACCAAGG + Intergenic
1113817894 13:113187963-113187985 AAGTATTCATTTAGGAAACACGG + Intronic
1114081184 14:19202326-19202348 GTGTATTCCTTTATGTAAAATGG - Intergenic
1114586751 14:23821986-23822008 ATACATTGCTTTAGGTAATATGG + Intergenic
1114793924 14:25690783-25690805 ATTTATTTCATTAGGTTAAATGG + Intergenic
1115101712 14:29709226-29709248 ATTTATTTCCTTAAGTAAAAGGG + Intronic
1115431226 14:33321057-33321079 ATGTATTTATTTTGTTATCAGGG + Intronic
1115451326 14:33551324-33551346 AGGTATTTCTTTAGGTAAGGAGG - Intronic
1116011906 14:39361221-39361243 ATAGATTGCTTTAGGTAATATGG + Intronic
1116346116 14:43796703-43796725 ATTTTTGTCTTCAGGTAACAGGG - Intergenic
1117919899 14:60718694-60718716 TTGCATTTCTTTAGGCAAAATGG - Intronic
1117931984 14:60853120-60853142 ATGAATTTCTTTGGGCAATATGG + Intronic
1118067492 14:62207585-62207607 ATGTTGTTCTTTATGTGACAAGG + Intergenic
1119811223 14:77521356-77521378 ATGTATTTTGTTAGGGAAAATGG - Intronic
1120272245 14:82327787-82327809 TTGTATTTCTTTTGTTAACCAGG + Intergenic
1120440770 14:84535999-84536021 ATTTTTTCCTTTAGGTAAAATGG - Intergenic
1120839823 14:89075789-89075811 ATTTATACCTTTAGGTGACAGGG + Intergenic
1121610720 14:95276946-95276968 ATTTTTTTTTTTGGGTAACATGG + Intronic
1122184067 14:99976212-99976234 ATTTATTTATTTAAGTGACAGGG + Intronic
1124241836 15:28034768-28034790 ATGTATTTGTTTTTGTGACAGGG - Intronic
1125190242 15:36983719-36983741 ATGGATTGCTTTAGGTAGTATGG + Intronic
1126061905 15:44791120-44791142 ATGTATTACTTTACTTCACAAGG + Intergenic
1126672057 15:51125411-51125433 ATTTATTTATTTTGGAAACAGGG + Intergenic
1126791523 15:52226072-52226094 TTTTTTTTCTTTATGTAACAGGG - Intronic
1134809960 16:17158844-17158866 ATGAATTTCTTGAAGTCACACGG - Exonic
1135239232 16:20788835-20788857 ACATATTTCTTTAGATAACTGGG + Intronic
1135624924 16:23986258-23986280 ATGTATTTATTTTTGAAACAGGG + Intronic
1135706085 16:24676297-24676319 ATGTATTTATTTATTTAAGATGG + Intergenic
1137388502 16:48061666-48061688 CTGTATTTCTTTATGTTATATGG + Intergenic
1137519836 16:49183201-49183223 ATGTATGTCTTTAACTAAAAAGG + Intergenic
1137973809 16:53012968-53012990 ATTTATTTATTTAGGAGACAGGG - Intergenic
1138814415 16:60187883-60187905 ATGTATTTATTTATTTAAGAAGG + Intergenic
1141075294 16:81000867-81000889 ATGTTTTTCTTTTTGTAAAACGG - Intronic
1145191845 17:20848577-20848599 ATGGACTTTTTTAGGTAGCATGG + Intronic
1145402056 17:22548610-22548632 ATGGACTTTTTTAGGTAGCATGG + Intergenic
1147225091 17:38970234-38970256 ATGTTTTTCTTTTCGGAACAAGG + Intergenic
1147231581 17:39023170-39023192 GTGTATTTCTTCATTTAACACGG + Intergenic
1148672535 17:49421563-49421585 ATTTATTTATTTAGGAGACAGGG + Intronic
1149901254 17:60481416-60481438 ATTTATTTATTTAGGAGACAGGG - Intronic
1150984189 17:70176636-70176658 ATGCTTCTCTTTAGGGAACAAGG + Exonic
1151246845 17:72801713-72801735 ATGTATATCTATGAGTAACAAGG + Intronic
1151262029 17:72923636-72923658 ATGTGTAGCTTTAGGTGACAAGG + Intronic
1151688563 17:75665164-75665186 TTGTATTTTTTCAGGTAACAAGG - Exonic
1152216123 17:79033694-79033716 ATTTATTTATTTAGGAGACAGGG - Intronic
1152414426 17:80149923-80149945 CTGTTTTTCTTTAGTCAACAAGG - Intergenic
1152952363 17:83246114-83246136 ATGTATATCTTATGGTTACATGG + Intergenic
1153518305 18:5925979-5926001 ATTTATTTATTTTGGAAACAAGG - Intergenic
1153899303 18:9602034-9602056 ATTCAGTTCTATAGGTAACAAGG - Intronic
1154907531 18:20596273-20596295 ATGTATGTCCTCAGCTAACAGGG - Intergenic
1155531251 18:26768964-26768986 ATTTATTGCTTTAGGACACACGG - Intergenic
1155601467 18:27553596-27553618 ATTTATTTCTTTACAAAACAAGG + Intergenic
1155644518 18:28061470-28061492 TTGTATTTCTTTAGTAAAGATGG - Intronic
1156190740 18:34717427-34717449 CTGTATTTCTGTAGATAAAAGGG - Intronic
1156794305 18:41023637-41023659 ATGTAGTTCTTTTGGTAAAAAGG + Intergenic
1156885124 18:42126482-42126504 CTCTATTTCTTCATGTAACACGG - Intergenic
1158608685 18:58919180-58919202 ATTTACTTCTTTTGGTAACGGGG - Exonic
1159194885 18:65100640-65100662 CTGTTATTCTTTAGGTCACATGG - Intergenic
1159554067 18:69926635-69926657 ATCTAATTCTTCAGGGAACATGG + Intronic
1159907993 18:74115663-74115685 ATGTATTTCTTTAGAAAGTATGG - Intronic
1161128893 19:2576551-2576573 ATTTATTTATTTAAGAAACAGGG + Intronic
1164201900 19:23025943-23025965 ATGTATTCCTGCAGGTCACAGGG + Intergenic
1166597717 19:44065004-44065026 ATGTAGGTCTTTAGGTCACAGGG - Intronic
1167755209 19:51408643-51408665 TTGTATTTTTTTAGGTGAGACGG + Intergenic
1168614958 19:57830152-57830174 ATGTAGTTCCCTAGGTAACAAGG - Intronic
1168622304 19:57889157-57889179 ATGTAGTTCCCTAGGCAACAAGG + Intronic
1168728351 19:58604337-58604359 ATGTATATCTTATGGTTACATGG + Intergenic
925054317 2:845004-845026 ATGCATTCCTTTAGGCATCAAGG + Intergenic
927145184 2:20160356-20160378 ATTTAGTTCTTTAAGTAACCTGG + Intergenic
929286281 2:40138978-40139000 CTGTATTCATTTAGGTAACTAGG - Intronic
929325508 2:40605976-40605998 ATGTTTTTGTTTAAGTAAAAAGG + Intronic
930491252 2:52075682-52075704 ATGTATTTGTGCAGGTCACAGGG - Intergenic
930769263 2:55115448-55115470 ATCTATATATATAGGTAACAGGG + Intergenic
933052823 2:77621127-77621149 ATAAATTTCTTTAGGTAATATGG - Intergenic
933073834 2:77897283-77897305 ATGTATTCCTGCAGGTCACAGGG - Intergenic
933485227 2:82913221-82913243 ATGTATTGCTTTGGGTAGTATGG - Intergenic
934883879 2:98007681-98007703 TTCTATTCCTGTAGGTAACAAGG + Intergenic
935501196 2:103841707-103841729 ATTTATTTATTTGGGAAACATGG + Intergenic
935793833 2:106620037-106620059 ATGTCTTTGTTTTGGTAATAGGG + Intergenic
936570206 2:113606673-113606695 ATGTATATCTTATGGTTACATGG - Intergenic
937176322 2:119939471-119939493 TTGTATTTCTTGTGGAAACAGGG + Intronic
937271104 2:120653555-120653577 AAGAACTTCCTTAGGTAACATGG - Intergenic
937662621 2:124447699-124447721 ATGTATTTATATAGGAAACAGGG + Intronic
937688816 2:124730132-124730154 ATGCATTTTTTCAGATAACATGG - Intronic
938185067 2:129224424-129224446 ATCTATTTTTTCAGGTACCAGGG + Intergenic
938498446 2:131817166-131817188 GTGTATTCCTTTACGTAAAATGG + Intergenic
938858087 2:135336679-135336701 ATGAATTTTTTTATGAAACAGGG + Intronic
939344835 2:140950658-140950680 TTGTATTTCTTTAGTAAAGATGG + Intronic
939386810 2:141511022-141511044 CTGTCTTTCTTAAGGTAATAAGG + Intronic
939663746 2:144923597-144923619 ATGTATTTTTTTAAATAATAAGG - Intergenic
940494421 2:154407257-154407279 ATGTATTTCTCTAAGTATAATGG + Intronic
941264718 2:163347350-163347372 ATGTATTTCTTTATGTACTTGGG - Intergenic
941758577 2:169215573-169215595 ATCTATTTATTTACGTAGCAAGG - Intronic
943551227 2:189341944-189341966 ATCTTTTTCTTTAGATAATACGG - Intergenic
943795036 2:191981660-191981682 GTGTATTTGTTTGAGTAACATGG + Intronic
944199662 2:197092326-197092348 ATGTGTTTCTTTATGAAGCATGG - Intronic
945754098 2:213824810-213824832 ATAGATTTCTTTGGGTAATATGG + Intronic
946928091 2:224645500-224645522 ATACATTTCTTTAGCCAACAAGG - Intergenic
947034369 2:225835362-225835384 AAGTATTTGTTTAGATAACTAGG + Intergenic
948519573 2:238527169-238527191 ATGTTACTTTTTAGGTAACATGG - Intergenic
949088609 2:242179978-242180000 ATGTATATCTTATGGTTACATGG + Intergenic
1169077641 20:2771213-2771235 ATTTATTTTTTTAAGCAACAAGG - Intergenic
1170226145 20:13994122-13994144 TTGTATTTTTTTAGTAAACATGG - Intronic
1170450409 20:16477658-16477680 AGGTCTTTGTTTAGGTTACAGGG + Intronic
1170501756 20:16981952-16981974 ATGTATTTATTAAAGTAAAAAGG - Intergenic
1170927182 20:20736210-20736232 ATGTATTACTTTTGATAACTAGG + Intergenic
1172830481 20:37829836-37829858 ATGTATTTATTTAGGAGACAGGG + Intronic
1173535936 20:43813444-43813466 ATGTATTTATTTTTATAACAGGG + Intergenic
1174033184 20:47647456-47647478 AAGAATTTCTTTAGTTGACAGGG - Intronic
1174081775 20:47974976-47974998 ATGTATCTCTTTATTTAAAAAGG - Intergenic
1174584838 20:51600300-51600322 AACTAATTCTTTAGGCAACATGG - Exonic
1174681094 20:52409205-52409227 ATGTAGTTCTTTAGGTGAGAGGG + Intergenic
1177434174 21:21029066-21029088 ATGTTTTAGTGTAGGTAACAAGG + Intronic
1177994033 21:28073372-28073394 ATGGAAATATTTAGGTAACAAGG - Intergenic
1178063391 21:28876303-28876325 AAGTCATTCATTAGGTAACAAGG - Exonic
1180263776 21:46695939-46695961 ATGTATATCTTATGGTTACATGG + Intergenic
1180499589 22:15920360-15920382 GTGTATTCCTTTATGTAAAATGG + Intergenic
1181737977 22:24896970-24896992 ATGTATTTATTTATTTAAGATGG - Intronic
1182746880 22:32612830-32612852 ATTTATTTATTTAGGACACAGGG - Intronic
1183915279 22:41112991-41113013 ATGTATATCTTTCAGTAAAAAGG + Intronic
1184862801 22:47184431-47184453 ATGTCTTTGTTTTGGTATCAGGG - Intergenic
1185430005 22:50804299-50804321 ATGTATATCTTATGGTTACATGG + Intergenic
949148410 3:732900-732922 ATGTATTTTTTTAGAGAAAAAGG - Intergenic
950608715 3:14110192-14110214 ATGTATTTATTTTAGAAACAGGG - Intergenic
950759650 3:15209780-15209802 ATGTAAGTCTATAGGAAACAAGG - Intronic
950763543 3:15256295-15256317 TTGTATTTCTATAGGAGACAGGG - Exonic
950763547 3:15256349-15256371 TTGTATTTCTATAGGAGACAGGG - Intronic
951959747 3:28304185-28304207 ATGTATTTTTTTAAGAGACAGGG - Intronic
952397798 3:32936466-32936488 ATGTATTTCTTTGGGTCTCCTGG - Intergenic
952526376 3:34214788-34214810 ATGTATTACTTTACTTCACAAGG - Intergenic
954551515 3:51485680-51485702 ATGTATTTCTTTTGGTTTTATGG - Intronic
954844359 3:53542571-53542593 ATTTATTTATTTAAGCAACAGGG - Intronic
954917426 3:54160923-54160945 ATGTTTTTCTTTCGGCAAAATGG - Intronic
955950943 3:64241457-64241479 ATGTATATATGTAAGTAACATGG + Intronic
956206806 3:66763138-66763160 CTGTAAGTCTTTAGCTAACAGGG + Intergenic
956399115 3:68857863-68857885 TTGTATTTCTTCAGGTAATATGG - Intronic
956503770 3:69915061-69915083 GTGTATTCCTTTATGTCACAAGG + Intronic
956614230 3:71155183-71155205 ATGTATTTTTAAAGGTAACCAGG + Intronic
957118144 3:76054279-76054301 ATTTAGTTCTTTAGGTCAGATGG + Intronic
957678131 3:83396525-83396547 ATGTATTTCTATAGGTTTGAGGG - Intergenic
957729580 3:84115866-84115888 ATGTATATGTTCAGGTCACAGGG + Intergenic
957896051 3:86422017-86422039 ATGTCTTTCTTTAGGAAAGGTGG + Intergenic
958082427 3:88763495-88763517 ATAAATTTCTTTGGGTAATATGG + Intergenic
958862816 3:99465951-99465973 ATGTATTTTTTTAGTTAGCTGGG - Intergenic
960607031 3:119517043-119517065 ATGTTTTTCTTTATTTGACAAGG + Intronic
960864616 3:122186429-122186451 ATATAATTCTTAAGATAACACGG + Intronic
962132162 3:132692606-132692628 ATTTATTTATTTAAGAAACAGGG - Intronic
962678598 3:137775540-137775562 ATGTATTCCTTTAGTTAGTAAGG + Intergenic
963597049 3:147341464-147341486 ATGTATTTGTTTTGGCCACATGG - Intergenic
963669580 3:148235012-148235034 ATGTAATGCTTTTAGTAACATGG + Intergenic
963701776 3:148635755-148635777 ATGTATTGCTTTGGGTGATATGG - Intergenic
964290059 3:155168464-155168486 ATATATTTATTTAAGTAAAATGG - Intronic
964530546 3:157663160-157663182 ATGCATTTATTTATGAAACAGGG - Intronic
965290853 3:166877789-166877811 TTGTATTGCTTAAGGAAACAGGG + Intergenic
967459022 3:189723747-189723769 ATGTATTTCTTAAGGATACCTGG - Intronic
970367808 4:15378130-15378152 AGCTAATTCTTTAGCTAACATGG + Intronic
970499176 4:16659695-16659717 ATGTATGTATATATGTAACAAGG + Intronic
970915230 4:21324834-21324856 ATGGATTGCTTTAGGTAGTATGG + Intronic
971031286 4:22640050-22640072 TTGTATTTCTTTAGTAAAGACGG - Intergenic
971723966 4:30284082-30284104 AAGTATTTCTTTACTAAACAAGG - Intergenic
971754797 4:30693810-30693832 ATGTACTTCTTAAGGGCACATGG - Intergenic
971839990 4:31838566-31838588 CTATATTTCTTTAGGGAACTAGG - Intergenic
971874976 4:32296886-32296908 TTGTATTTTTTTAGGAAAGATGG - Intergenic
971990734 4:33889905-33889927 ATGAAATTCTCTGGGTAACATGG + Intergenic
972168425 4:36315141-36315163 ATATATTGCCTTAGGAAACATGG + Intronic
972501417 4:39681365-39681387 ATGTTGTTCTTTGGGTATCAAGG + Intergenic
972501979 4:39686509-39686531 ATTTATTTATTTAGGGGACAGGG + Intergenic
972945231 4:44246106-44246128 ATGTATTTATTTCTGTTACATGG + Intronic
974447191 4:62000392-62000414 ATGTATTTCTTTAGGTAATGTGG + Intronic
974849021 4:67383503-67383525 ATGTATTTCTATAGGTTTGACGG - Intergenic
974938593 4:68437162-68437184 ATTTATTTCTTCAGGTAGGAAGG - Intergenic
975023208 4:69516609-69516631 ATGTATTTATTTATTTAAGACGG + Intronic
975251908 4:72190102-72190124 ATGTATTACTTTGGGGAGCATGG - Intergenic
975988522 4:80230945-80230967 ATGTATTTCATTGGTTTACAGGG - Intergenic
976691573 4:87873108-87873130 ATCTATAGCTTTAGGTAAGATGG - Intergenic
977776274 4:100923176-100923198 ATACATTTCTTTGGATAACATGG - Intergenic
977941806 4:102868032-102868054 ATGGTTTTCTTTATGTTACAAGG - Intronic
978250183 4:106621428-106621450 ATGTATTTATTTAGGGACCCAGG + Intergenic
980108346 4:128609882-128609904 TTGTTTTTCTTTTGGAAACAGGG - Intergenic
980229818 4:130034552-130034574 TTGTATTTTTTTAGTAAACACGG - Intergenic
980806771 4:137825655-137825677 ATGGCTTTCCCTAGGTAACAGGG - Intergenic
980858437 4:138469278-138469300 TTGTATTTCTTTAGTCAAGACGG - Intergenic
981752739 4:148108423-148108445 ATGTCATTCTTTAGGTCAAAAGG - Intronic
981792410 4:148553341-148553363 ATGTATTTATTTTTGGAACAGGG - Intergenic
982738872 4:159037051-159037073 AAGTAATTCTTTAGTAAACAAGG + Intronic
983738747 4:171100268-171100290 TTGTATTTCTATAGGAAAGAAGG - Intergenic
983973523 4:173903179-173903201 ATGTATTTATTTGGCTCACAGGG - Intergenic
984058502 4:174961231-174961253 ATGTATTACTGTATGTAAAAAGG - Intronic
984371134 4:178865948-178865970 ATGTATATCTGTAGTTAAAATGG + Intergenic
985466438 4:190201185-190201207 ATGTATATCTTATGGTTACATGG + Intergenic
986530356 5:8730738-8730760 AAGTAAGTGTTTAGGTAACAAGG - Intergenic
986923241 5:12714070-12714092 TTTTATTTCTTTATTTAACATGG + Intergenic
987454863 5:18130792-18130814 ATTTATTTATTTATGAAACAGGG - Intergenic
987610025 5:20191126-20191148 ATGTTTTTCTTTAGTAATCATGG + Intronic
988430045 5:31109103-31109125 ATGTGCTTCTTTTGTTAACAAGG - Intergenic
989564714 5:42890540-42890562 ATATATTTCTTAAAGAAACAGGG + Intergenic
990055839 5:51577050-51577072 TTGTATTTCTTTAGTAGACATGG - Intergenic
990206188 5:53432109-53432131 ATGTATTTCTTAAGGGAAAATGG - Intergenic
990613539 5:57483869-57483891 CTGTATTTCTATATGAAACATGG - Intergenic
990857072 5:60280229-60280251 ATGTTTTTCTTTTGGTCCCAAGG + Intronic
991187902 5:63831963-63831985 AAGTATTTCACTAGGTACCATGG - Intergenic
991613519 5:68472378-68472400 AAATATTTCTCTAGGTAGCAAGG + Intergenic
993388722 5:87291522-87291544 ATTTATTTATTTAGGAGACAGGG - Intronic
993853606 5:93042531-93042553 AAGTTTTACTTTATGTAACATGG + Intergenic
994703606 5:103170211-103170233 ATGAATTTATTTAAGTTACAAGG - Intronic
994832553 5:104804533-104804555 ATATATTGCTTTGGGTAGCATGG - Intergenic
994852192 5:105070207-105070229 ATGTATTACCTTATGTAACTAGG + Intergenic
995376808 5:111483040-111483062 ATCTATTTCTTAAGGCACCAGGG + Intronic
995401165 5:111743346-111743368 ATATATTTCTTGAGGTCACAGGG - Intronic
996324210 5:122253648-122253670 GTGGATTTCTTTAGGCAATATGG + Intergenic
996829555 5:127724940-127724962 ATGGATTTCTTTAGTTGAGATGG - Intergenic
996910259 5:128648921-128648943 ATGTATTTCTTCTAGAAACATGG + Intronic
997295217 5:132764674-132764696 ATGTATTTCCTCAGGGAGCAGGG + Intronic
997573440 5:134953263-134953285 ATGTTTTTCTTTACTTAACTGGG + Intronic
997862952 5:137435614-137435636 ATGTATTTCTTTAAGTAAAGTGG + Intronic
998433861 5:142090064-142090086 ATGTCTTTCTTTATGTACTAGGG - Intergenic
998733930 5:145113134-145113156 ATGTATTTCTAGAGGAATCATGG - Intergenic
999066851 5:148696612-148696634 ATGCACTTCTGTAGGTAACGGGG + Intergenic
999540696 5:152569458-152569480 ATTTATTTCTTTTGGAGACAGGG + Intergenic
1000019657 5:157308187-157308209 ATGTACCTCTTTAAGTGACAAGG - Intronic
1000721143 5:164708925-164708947 TTGAATTTCTTTAAGTCACACGG + Intergenic
1001427319 5:171631291-171631313 ATGTATTACTTTAGTAATCAGGG - Intergenic
1001853796 5:174993123-174993145 ATGCATTTCTTCATGCAACATGG - Intergenic
1002746390 5:181477516-181477538 ATGTATATCTTATGGTTACATGG + Intergenic
1003038817 6:2668763-2668785 ATTTATTTTTTTAAGTAAGAAGG + Intronic
1003381260 6:5626359-5626381 AAGTATTTCTGTAGGTCCCAGGG + Intronic
1007638963 6:43320892-43320914 ATTTATTTTTTTAAGAAACAGGG - Intronic
1007853260 6:44826055-44826077 GTCTCTTTCTTTAGGTATCATGG + Intronic
1008315021 6:50029642-50029664 GTAGATTTCTTTGGGTAACATGG - Intergenic
1009670443 6:66741573-66741595 ATGTTTTTTTTTAAGTAAAAGGG + Intergenic
1010122930 6:72400214-72400236 ATGTATTTATTTCTTTAACATGG + Intronic
1010773646 6:79861168-79861190 ATGTGTTGCTTTAGATAAGAAGG - Intergenic
1012005852 6:93712182-93712204 ATATATTGCTTTAGGTAGTATGG + Intergenic
1012079763 6:94741302-94741324 ATGTATTGCTTTTGGCAATATGG - Intergenic
1012219802 6:96635418-96635440 ATTTATTACTCTAGGTAGCATGG + Intergenic
1012724791 6:102796914-102796936 ATGTATTTCTGTAGGTTATTGGG - Intergenic
1012889046 6:104878455-104878477 ATCTATTTCTTTATATGACATGG + Intergenic
1014014125 6:116510287-116510309 ATGTATTTATTTATGAGACAGGG + Intronic
1014404742 6:121037380-121037402 GAATATTTATTTAGGTAACAAGG + Intergenic
1014474422 6:121854634-121854656 GTGAAGTTCTTTAGGTAACTGGG - Intergenic
1014885742 6:126779021-126779043 AAATATTTCATTAGGGAACAAGG + Intergenic
1015128366 6:129781108-129781130 ATGCATGTCTTTGGGGAACAGGG - Intergenic
1015863104 6:137701051-137701073 AAATATTTCTTAAGTTAACAAGG + Intergenic
1016195401 6:141330937-141330959 ACATATTTCTTTTGGTATCATGG - Intergenic
1016341414 6:143065220-143065242 ATGTATATGTGTAGGTCACAGGG + Intronic
1016522219 6:144959048-144959070 ATGAATTTATTTAGGAAACATGG - Intergenic
1017987198 6:159454642-159454664 AGGTATTTATTTAGGAATCAGGG - Intergenic
1018276815 6:162141121-162141143 ATTTATTTATTTTGGTGACAGGG - Intronic
1021210142 7:17840681-17840703 ATGTTTTTCTTTAGAAACCATGG - Intronic
1021415167 7:20375923-20375945 ATAAAATTCTTTAGGTAAAATGG + Intronic
1022203385 7:28139365-28139387 ATGTATTTCATTTGGAAAAAGGG + Intronic
1022560871 7:31347627-31347649 ATTTAATTCTTAAGGTAGCAAGG - Intergenic
1022563758 7:31376020-31376042 ATGTATTTATTTATGACACAAGG - Intergenic
1023020271 7:36005826-36005848 ATGGATGGCTTTTGGTAACATGG + Intergenic
1023758072 7:43438782-43438804 ATGTATTTCTTTAGGTAACAGGG + Intronic
1025072199 7:55910031-55910053 ATGTATTTTTTTAAGAGACAGGG + Intronic
1026324499 7:69297119-69297141 ATTTATTTATTTTGGAAACAGGG - Intergenic
1027718479 7:81706765-81706787 ATATATTTGGTTTGGTAACAGGG + Intronic
1027817894 7:83001411-83001433 ATGTATTCAGTTATGTAACATGG - Intronic
1027918887 7:84364579-84364601 ATGTATTTTGTTATGTGACATGG + Intronic
1027939547 7:84657245-84657267 ATGTTTTTCTTTCTGGAACATGG - Intergenic
1028859635 7:95634309-95634331 ATGAATTTCTTTTTGTAAAATGG - Intergenic
1029001081 7:97155002-97155024 ATGTATTGCCACAGGTAACAAGG - Intronic
1029048922 7:97662657-97662679 ATGTATTTCTTTTGGTCTAAGGG - Intergenic
1029336472 7:99904182-99904204 ATCTATGTCTTTAAGTAAAATGG - Intronic
1029664490 7:101986348-101986370 ATGTATTTATTTAGAATACAAGG + Intronic
1030560867 7:111084259-111084281 CTGTAATTCTCTAGGTAACGAGG + Intronic
1030766280 7:113413689-113413711 ATCTACTTTTTTAGGTAATATGG - Intergenic
1033187054 7:139237301-139237323 ATTTATTTATTTTGGAAACAGGG + Intronic
1033261332 7:139846349-139846371 ATCTATTGCTTAAGGTCACAAGG - Intronic
1033976735 7:147111941-147111963 ATGTATTGCTTTGGGCAATATGG + Intronic
1034239999 7:149603023-149603045 ATTTTTGTCTTTAAGTAACAGGG - Intergenic
1035289541 7:157828941-157828963 CTGTATTTCTTTATGCATCATGG + Intronic
1036530262 8:9578594-9578616 ATGAATTTCTATAGATAGCATGG + Intronic
1036735541 8:11312049-11312071 ATTTATTTATTTAGGAGACAGGG + Intronic
1037278335 8:17205634-17205656 ATGTTTTTGTTTTGTTAACAGGG + Exonic
1037544211 8:19902075-19902097 ATTTTTTTCTTTAGAAAACAAGG - Intronic
1038247717 8:25874690-25874712 ATTTATTTATTTAAGAAACAAGG + Intronic
1038628696 8:29219736-29219758 ATTTATTTATTTTGGAAACAGGG - Intronic
1039124822 8:34189644-34189666 ATTTATTCCTTTAGGTTGCAGGG - Intergenic
1039499341 8:38004315-38004337 ATGTATTTGTGCAGGTCACAGGG - Intergenic
1040896883 8:52377151-52377173 ATGTATTGCTGTAGACAACATGG + Intronic
1042793106 8:72630795-72630817 ATGCATTTTTTTTGGTAAAAGGG + Intronic
1043327114 8:79066044-79066066 ATGTATTTGTTTAGACAATAAGG + Intergenic
1044733762 8:95256270-95256292 ATGTATTTCCTGAGATAAAATGG + Intronic
1045079690 8:98612006-98612028 ATGTATTTATTTATTTAGCAAGG - Intronic
1046414152 8:113889479-113889501 AAGTGTTTCTTTATGTAATAAGG + Intergenic
1047031789 8:120889974-120889996 ATTTATTCATTTATGTAACATGG + Intergenic
1047153012 8:122285649-122285671 ATGCATTTCTTTTTGAAACAGGG + Intergenic
1047191870 8:122685663-122685685 ATGTTATCCTGTAGGTAACAGGG - Intergenic
1047670907 8:127145803-127145825 ATCTTTTTCTTTAGGTAATGAGG - Intergenic
1048257862 8:132918942-132918964 ATGTATTAATGTATGTAACAGGG + Intronic
1048646604 8:136427959-136427981 AAGTACTTCTTTAGCTATCATGG - Intergenic
1048888065 8:138924547-138924569 CTGGTTTTCTTTAGGGAACAGGG + Intergenic
1049029477 8:140023772-140023794 AGGTTTTTCTTTAGGAAACCAGG - Intronic
1049816464 8:144605252-144605274 ATTTATTTCTTGAGGAGACAGGG - Intronic
1052417411 9:28194200-28194222 ATGTATTTCTTCTGATACCATGG - Intronic
1053419465 9:37968085-37968107 AAGTACTTCTTTATGCAACATGG + Intronic
1055222377 9:73952188-73952210 GTAGATTTCTTTAGGTAGCATGG + Intergenic
1055496912 9:76864434-76864456 ATGTATTTCTTTAGGATCCAGGG - Intronic
1058046116 9:100358687-100358709 ATCTATTACTTTACTTAACAAGG - Intergenic
1058138402 9:101333418-101333440 ATGTATTTCTGTCAGTAACTTGG + Intergenic
1058221197 9:102304808-102304830 ATGGATTGCTTTAGGTAGTATGG + Intergenic
1058398100 9:104579424-104579446 ATGTATTTTGTTTGGTCACATGG + Intergenic
1058774940 9:108273684-108273706 ATTTATTTATTTAGGCAACCTGG - Intergenic
1059010627 9:110455030-110455052 ATGTATTTATTTAAGTTAAAAGG + Intronic
1059290888 9:113222428-113222450 AAGTATTTCTTTGGTTAACCTGG + Intronic
1061353025 9:130081196-130081218 ATGTATTTATTTCGGAGACAGGG - Intronic
1185721485 X:2385656-2385678 ATGCTTCTCATTAGGTAACAGGG - Intronic
1187543731 X:20226162-20226184 ATTTATTTATTTTGGAAACAGGG - Intronic
1188081674 X:25850474-25850496 ATGTATTTCTTCACTTCACATGG + Intergenic
1188228098 X:27626671-27626693 ATGTATTTATTCATGTTACATGG - Intronic
1188332503 X:28892516-28892538 ATGTATATGTGTAGGTCACAGGG + Intronic
1188333358 X:28898110-28898132 ATGTATATGTGTAGGTCACAGGG + Intronic
1188456936 X:30377875-30377897 ATGCTTTTCTTAAGCTAACATGG - Intergenic
1188553132 X:31382954-31382976 ATGTATATGTGTAGGTCACAGGG - Intronic
1188846714 X:35081238-35081260 ATGAATTGCTTTAAGTATCAAGG + Intergenic
1189243804 X:39546984-39547006 ATGAATTACTTTGGGTAATATGG - Intergenic
1189828967 X:44951011-44951033 TTGAATTTTTTTAGGTAAGATGG - Intronic
1190390482 X:49926408-49926430 ATGTCTGTCTTTAGATGACAAGG - Intronic
1190710613 X:53066091-53066113 ATTTATTTATTTTGGAAACAGGG - Intronic
1193149175 X:78106658-78106680 ATTGATTTGTTGAGGTAACATGG + Intronic
1193309919 X:79994328-79994350 GTGGATTTCTTTGGGTAGCATGG - Intergenic
1193620166 X:83743102-83743124 ATACATTTCTTTGGGTATCACGG - Intergenic
1193741228 X:85219975-85219997 CAGTATTTCTTTCAGTAACATGG - Intergenic
1194403537 X:93467168-93467190 ATTTATTTATTTTGGTGACAGGG - Intergenic
1195201855 X:102558896-102558918 AAGTATGTCCTGAGGTAACATGG + Intergenic
1196246903 X:113411051-113411073 ATGTATTTATTTATTTACCATGG + Intergenic
1196542476 X:116925364-116925386 ATGTATTTGTGCAGGTCACAAGG + Intergenic
1197031829 X:121825613-121825635 GTGTATTGCTTTAGGCAGCATGG - Intergenic
1197099208 X:122631848-122631870 ATAGATTTCTTTAGGTAGTATGG + Intergenic
1197158003 X:123291260-123291282 ATGTATCTATTAAGATAACAAGG + Intronic
1197260268 X:124309882-124309904 ATTTATTTATTTTGGTCACAAGG - Intronic
1197310475 X:124899202-124899224 ATGTAGTACTTTAGGTAACAAGG - Intronic
1197559211 X:127996959-127996981 GTGCATTTCTATATGTAACAGGG + Intergenic
1198149242 X:133892054-133892076 ATGCATTTGTTTATCTAACACGG - Intronic
1199040247 X:143106529-143106551 ATGGATTGCTTTGGGTAGCACGG - Intergenic
1199327501 X:146516100-146516122 ATAGATTGCTTTAGGTAGCATGG + Intergenic
1199446815 X:147933723-147933745 ATGTATTACTTTATATAAAATGG - Intronic
1199587203 X:149428012-149428034 ATACATTACTTTAGGTAATATGG - Intergenic
1200579303 Y:4929333-4929355 ATGTATTGCTTTGGGTACTATGG - Intergenic
1201547660 Y:15183817-15183839 ATGTATGTGTTTTGATAACAGGG - Intergenic
1201604778 Y:15772622-15772644 ATGTATATGTGTAGGTCACAGGG - Intergenic