ID: 1023759234

View in Genome Browser
Species Human (GRCh38)
Location 7:43448203-43448225
Sequence TTGTTGCAGCCTTATCTATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 148}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023759234_1023759236 23 Left 1023759234 7:43448203-43448225 CCACATAGATAAGGCTGCAACAA 0: 1
1: 0
2: 0
3: 6
4: 148
Right 1023759236 7:43448249-43448271 GTCTGAACTGACAACTATACAGG 0: 1
1: 0
2: 0
3: 6
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023759234 Original CRISPR TTGTTGCAGCCTTATCTATG TGG (reversed) Intronic
905278924 1:36836656-36836678 TTGGTCCAGCCCCATCTATGAGG + Intronic
908929378 1:69298886-69298908 ATTTTGCAGACTTATTTATGTGG + Intergenic
909817993 1:80020908-80020930 TTGTTTCAGCTTTATCCATTGGG + Intergenic
910984099 1:92988409-92988431 TTTTTGCAACCATATTTATGAGG + Intergenic
917305433 1:173619220-173619242 TTTTTGCAGACTTGTTTATGTGG - Intronic
918334215 1:183491878-183491900 TTGTTGCTGCCTTCTCTACAGGG + Intronic
1063188271 10:3669854-3669876 TTGTTGCAGGCATATCTAGAGGG - Intergenic
1065163294 10:22946538-22946560 TTGTTCCAGCCTTGACTATTGGG - Intronic
1065876713 10:30003370-30003392 ATGGTACAGCCTTATATATGTGG + Intergenic
1069147130 10:64907613-64907635 GTGTTGGGGCCTTATCTATTGGG + Intergenic
1070769174 10:79072327-79072349 ATGTTGGAGGCATATCTATGGGG - Intronic
1073166565 10:101459226-101459248 TCCTTGCATCTTTATCTATGAGG - Intronic
1074989879 10:118695082-118695104 TTGTTACAGCCTTTTCCAAGAGG - Intronic
1079493767 11:21017825-21017847 TTCTATCATCCTTATCTATGAGG + Intronic
1081100021 11:38989678-38989700 TTGTTTAAGCCTTAACTAAGTGG - Intergenic
1082765882 11:57167301-57167323 GTGTTGCACCTTTATCCATGTGG + Intergenic
1085198120 11:74684273-74684295 ATGATGCAGCCTTACCTGTGAGG - Intergenic
1087337405 11:96862105-96862127 ATTTTGCAGACTTATTTATGTGG + Intergenic
1090309295 11:125720584-125720606 TTCTTGCAGCATTAGCTATATGG + Intergenic
1092042866 12:5400632-5400654 ATGTTGCTGCCTTATCTTTTTGG - Intergenic
1094651504 12:32381867-32381889 TTTTTGCAGCCTTAAATATAAGG - Intronic
1097235910 12:57539491-57539513 AAGTGGGAGCCTTATCTATGTGG - Intronic
1097655222 12:62352057-62352079 TTTTTGAAACCTTATGTATGTGG + Intronic
1098787264 12:74775853-74775875 TAGTAGCAGCCTTAAATATGTGG - Intergenic
1101425031 12:104581159-104581181 TTCTTGCATCCTTATCCTTGAGG + Intronic
1103138509 12:118528236-118528258 TAATTTCAGCCTCATCTATGGGG - Intergenic
1106674767 13:31946940-31946962 TTATTGGAGCCTTCTTTATGGGG + Intergenic
1114933243 14:27502226-27502248 GCGTTGCAGCCTTATTTCTGGGG + Intergenic
1115311801 14:31985914-31985936 TTATTTCAGTCTTATTTATGGGG + Intergenic
1115748860 14:36467648-36467670 GTGTTCCCCCCTTATCTATGGGG - Intergenic
1116317393 14:43415907-43415929 ATTTTGCAGACTTATTTATGTGG + Intergenic
1116909012 14:50437487-50437509 TTGTGGCAGCCTTTTGTATCAGG + Exonic
1117048885 14:51840905-51840927 TTGTTGTAGCATTATACATGAGG - Intronic
1117240531 14:53828160-53828182 TTATTGCTGCCTTTTGTATGAGG - Intergenic
1117737201 14:58780040-58780062 TTTCTGCAGCAATATCTATGAGG + Intergenic
1119504695 14:75162348-75162370 TTGTTTCAGCTTTAGCTATTGGG - Intronic
1120541807 14:85760393-85760415 TTGTTGTAGCCTTTTCTTTCTGG + Intergenic
1123171781 14:106379501-106379523 TTTTTAGATCCTTATCTATGTGG - Intergenic
1123195499 14:106611973-106611995 TTTTTACACCCTTATGTATGTGG - Intergenic
1123496455 15:20831953-20831975 TTTTTGCAGACTTATGTATGTGG + Intergenic
1123553690 15:21405543-21405565 TTTTTGCAGACTTATGTATGTGG + Intergenic
1123589935 15:21842908-21842930 TTTTTGCAGACTTATGTATGTGG + Intergenic
1124467608 15:29952418-29952440 TTGTTTCAGCTTTCTCTGTGGGG - Intronic
1125381105 15:39087644-39087666 TTGTTGAAGTCTAATCTATTTGG + Intergenic
1127125812 15:55811012-55811034 TTGCTCCAGCCTTCTCTATCAGG + Intergenic
1130574446 15:85079304-85079326 TTCTTACAGACTTATCTAAGAGG + Intronic
1131054695 15:89368429-89368451 TTGTTCCAGCCTGATTTATGGGG - Intergenic
1202962036 15_KI270727v1_random:132739-132761 TTTTTGCAGACTTATGTATGTGG + Intergenic
1134026844 16:10960842-10960864 TTGTTTCAGCCTTGGCTATTAGG + Intronic
1135637568 16:24091885-24091907 TTGTTCCAGCCTTCTCTCTATGG + Intronic
1137234319 16:46601452-46601474 TTCTTACAGCTTTGTCTATGTGG - Intronic
1137685806 16:50386040-50386062 TTGGTACAGCCTTATCTACTGGG + Intergenic
1137858421 16:51820207-51820229 CTGTTAAAGCCTTATCTATAGGG + Intergenic
1137966912 16:52943995-52944017 GTGTTGCAGGCTAATATATGCGG - Intergenic
1139120011 16:64004191-64004213 TGTTTGCAGCCTTATCTTTCAGG + Intergenic
1139469725 16:67171645-67171667 TTGCTCCAGCCTGAACTATGAGG - Intronic
1142554478 17:764272-764294 GTGCTGCAGCCCTAGCTATGTGG + Intronic
1143902272 17:10183284-10183306 CTGGTGCAGCATTATCGATGAGG - Intronic
1154454371 18:14507636-14507658 CTTTTGCAGACTTATGTATGTGG + Intronic
1155522498 18:26683192-26683214 CTGTTGGAGGCTTATCAATGGGG + Intergenic
1156896641 18:42254333-42254355 ATGTTGCAGACTTGTTTATGTGG + Intergenic
1159343423 18:67167027-67167049 TTGTTGTATCCTTTTCTATTTGG + Intergenic
1159473381 18:68885235-68885257 TTATTACATCCTTATCTTTGTGG - Intronic
1159768907 18:72525098-72525120 TTCATGCAGCCTTATCCATGAGG + Intergenic
1160463375 18:79056103-79056125 TTTTTGCAGCCTTGTCTGTCAGG - Intergenic
1161709161 19:5838209-5838231 TTTTTGCATCCTGATCTTTGTGG - Intronic
925530370 2:4853201-4853223 TTGATGCAGGCTTATATTTGAGG - Intergenic
929322265 2:40558556-40558578 TTTTTGCAGCATTATAAATGAGG + Intronic
929932237 2:46267207-46267229 TTGTTCCAGCCTTGGCTATTGGG - Intergenic
930991886 2:57666117-57666139 ATGTTGCAACCTTTGCTATGTGG + Intergenic
932007100 2:67938193-67938215 TTGTTCCAGCTCTGTCTATGTGG - Intergenic
933224990 2:79737753-79737775 TTGTCTAAGCCTTACCTATGGGG - Intronic
935522891 2:104130258-104130280 TTGTTCCAGCCTTGTATCTGTGG - Intergenic
935929746 2:108111662-108111684 ATTTTGCAGACTTGTCTATGTGG + Intergenic
938477625 2:131630399-131630421 ATTTTGCAGACTTATGTATGTGG - Intergenic
938983960 2:136554852-136554874 TTGCTGCAGCCCTGGCTATGTGG - Intergenic
939341476 2:140901108-140901130 TTGTTGCTTACTTATCTATCAGG - Intronic
939796929 2:146656544-146656566 TAGTTCCCCCCTTATCTATGGGG - Intergenic
941336782 2:164255316-164255338 TTGCTGTATCCTTATCTGTGAGG - Intergenic
942579749 2:177405118-177405140 TTGCTGCAGGCTTCTCTAAGTGG + Intronic
948144270 2:235696708-235696730 GTGCTGCAGACTTATCTGTGGGG + Intronic
948979122 2:241483820-241483842 TTCTTGCAGCCACATGTATGTGG - Intronic
1170187594 20:13608492-13608514 TAGTTGTAGCATTGTCTATGTGG - Intronic
1171329017 20:24320985-24321007 GTTTTGCAGCCTTCTCTGTGAGG + Intergenic
1173299670 20:41790651-41790673 GTGTTGCAGCCTGGTCTCTGTGG - Intergenic
1177598810 21:23283694-23283716 TTCTTGAATCCTTATCTCTGGGG - Intergenic
1181523254 22:23461092-23461114 TCGATGCACCCTTATCTGTGAGG - Intergenic
1181970307 22:26684771-26684793 TTGCTGCCGCCTTATTTGTGGGG - Intergenic
949388551 3:3533419-3533441 TTGTGCCTTCCTTATCTATGAGG - Intergenic
951441531 3:22729071-22729093 TTGTTACATCCTTTTATATGTGG + Intergenic
951809858 3:26687046-26687068 TTGTTGCAGGGTCATCTAGGTGG + Intronic
952994606 3:38867145-38867167 TTCTTTCAGCCTCATCTTTGAGG + Intronic
960256797 3:115519285-115519307 TTGATGCAGCTTTATCTAGATGG - Intergenic
963335566 3:143971277-143971299 TTGTTGGAGCTTCATCTTTGGGG - Intergenic
966090837 3:176133604-176133626 TTTTTGCAGCCTCAGTTATGGGG - Intergenic
970482820 4:16494865-16494887 TTTATTCAGCCTTATGTATGTGG + Intergenic
972139134 4:35934377-35934399 TTGGTGCAGGCTTATTTATAAGG + Intergenic
974233692 4:59152269-59152291 TTGTTTCTGCCTTGTCTTTGGGG - Intergenic
975400009 4:73925859-73925881 ATTTTGCAGACTTATTTATGTGG - Intergenic
976016555 4:80561358-80561380 TTATTGCAGCCTTCACTATCTGG - Intronic
978885491 4:113762047-113762069 TTGAGGCAGCCTTCTCTGTGCGG - Intergenic
980820984 4:138017202-138017224 TTGTTGCTACCTCATATATGTGG + Intergenic
981295412 4:143125753-143125775 TTGAGGCAGCCTAATCTATAGGG - Intergenic
988385216 5:30554140-30554162 ATGTTGCAGCCCTAGCTATTGGG + Intergenic
989033247 5:37141883-37141905 TGGTTTAAGCCTGATCTATGAGG - Intronic
989682405 5:44045145-44045167 ATTTTGCAGGCTTGTCTATGTGG + Intergenic
990360041 5:55009107-55009129 TTTTTGCAGACTTGTTTATGTGG - Intronic
991982623 5:72249051-72249073 TTGTAGCAGCCATGTATATGTGG - Intronic
992363269 5:76064546-76064568 TTGTTAAAGCCTTCTCTTTGTGG + Intergenic
995025503 5:107416501-107416523 TTGTTGAATCCTCATCTGTGAGG - Intronic
998602758 5:143601841-143601863 TTGGTGCCCCCTTGTCTATGTGG - Intergenic
1002251875 5:177934894-177934916 TTGTTGGCTCCATATCTATGTGG + Intergenic
1003128038 6:3371729-3371751 TTGTTACTGCTTTATCAATGTGG - Intronic
1005535365 6:26749824-26749846 TTGTTGTGGCAGTATCTATGAGG - Intergenic
1007806059 6:44448291-44448313 TTATTATAGCCTTATTTATGTGG - Exonic
1008504862 6:52219898-52219920 TTGTGGCAGCCTCATCCCTGTGG - Intergenic
1010576948 6:77543744-77543766 AAGCTACAGCCTTATCTATGAGG + Intergenic
1011040018 6:83019752-83019774 TGGTTTCAGCCTGATCCATGGGG + Intronic
1011934193 6:92754390-92754412 CTGTTACAGCCTTCTCCATGGGG - Intergenic
1012377839 6:98584110-98584132 TTCTTAGAGCCTTATCTATCAGG + Intergenic
1013896989 6:115101270-115101292 TTTTTGCAGGCTTGTTTATGTGG + Intergenic
1014183606 6:118410053-118410075 ATTTTGCAGACTTATTTATGTGG - Intergenic
1014257578 6:119178341-119178363 ATGTTTCAGCCTAATCCATGGGG + Exonic
1018519801 6:164635340-164635362 CTGGTGCAGCCCTATCTCTGGGG + Intergenic
1019588078 7:1815465-1815487 TCGATGCACCCTTATCTGTGAGG + Intergenic
1020360889 7:7325406-7325428 TTGTTTTAACCTTATCCATGTGG - Intergenic
1022802034 7:33786038-33786060 TTGTAGCATCATTATCCATGTGG - Intergenic
1022998013 7:35778372-35778394 TTCTTGCAGCCTGGTCTGTGTGG - Intergenic
1023759234 7:43448203-43448225 TTGTTGCAGCCTTATCTATGTGG - Intronic
1026649958 7:72208500-72208522 TTGTAGCAGGCATATCCATGTGG - Intronic
1027482759 7:78719042-78719064 ATGTTGCATCCTTATGTCTGTGG + Intronic
1028350786 7:89844882-89844904 TTGTTTCTACCTTTTCTATGAGG - Intergenic
1028521549 7:91736841-91736863 TTGTTTCATCCTTCTGTATGTGG + Intronic
1033245659 7:139714571-139714593 ATGTTCCAGCCTTCTCTCTGTGG + Intronic
1034761610 7:153677736-153677758 TTGCTGCAGAATTATCCATGGGG - Intergenic
1043324778 8:79036001-79036023 ATTTTGCAGACTTGTCTATGTGG - Intergenic
1044256810 8:90073297-90073319 TTGCTGCAGCCTCACCTGTGAGG + Intronic
1046100203 8:109605049-109605071 TTGTTGCATCCTTTTCCATCAGG - Intronic
1046117758 8:109804576-109804598 TTTTTGCAGACTTTACTATGTGG + Intergenic
1046217549 8:111169189-111169211 TGGTTGCACCATTATATATGTGG + Intergenic
1048421473 8:134282554-134282576 TTCTTACAGCCTGATCTATCTGG - Intergenic
1048520429 8:135148817-135148839 TTCTTTCAACCTTATCTGTGTGG + Intergenic
1053191985 9:36079438-36079460 TTGAGGAACCCTTATCTATGAGG + Intronic
1053230457 9:36403340-36403362 TAGTGGCAGCCTTTTCGATGGGG - Intronic
1058731011 9:107849927-107849949 TCTTTGCAGCCTCAGCTATGAGG + Intergenic
1058882266 9:109296096-109296118 TTGTTGCATATTTATTTATGTGG - Intronic
1191000014 X:55649765-55649787 TTGTTGCAGAATTCTCTTTGTGG + Intergenic
1194632137 X:96297945-96297967 ATTTTGCAGCCTTGTTTATGTGG - Intergenic
1194997452 X:100606795-100606817 TTGTTCCAGCCTTGTGTATCTGG + Intergenic
1194998312 X:100615999-100616021 TTGTTGCACTTTTAGCTATGAGG - Intergenic
1195104516 X:101591331-101591353 ATTTTGCAGACTTATTTATGTGG + Intergenic
1195907656 X:109861656-109861678 TTGTTGCAGCAGAATCTTTGAGG + Intergenic
1196538462 X:116876401-116876423 TTTTTGAGGTCTTATCTATGTGG - Intergenic
1197279827 X:124522220-124522242 TTGTGTGAGCCTTATCTAAGTGG + Intronic
1199113673 X:143963997-143964019 ATTTTGCAGACTTATTTATGTGG + Intergenic