ID: 1023761864

View in Genome Browser
Species Human (GRCh38)
Location 7:43471705-43471727
Sequence GGAGGCAGTCACCATCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 167}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023761858_1023761864 7 Left 1023761858 7:43471675-43471697 CCTCAAACCTCATTCCAAGTCTA 0: 1
1: 0
2: 0
3: 20
4: 183
Right 1023761864 7:43471705-43471727 GGAGGCAGTCACCATCAGAGAGG 0: 1
1: 0
2: 1
3: 14
4: 167
1023761859_1023761864 0 Left 1023761859 7:43471682-43471704 CCTCATTCCAAGTCTAAGCTGAG 0: 1
1: 0
2: 1
3: 16
4: 158
Right 1023761864 7:43471705-43471727 GGAGGCAGTCACCATCAGAGAGG 0: 1
1: 0
2: 1
3: 14
4: 167
1023761863_1023761864 -7 Left 1023761863 7:43471689-43471711 CCAAGTCTAAGCTGAGGGAGGCA 0: 1
1: 0
2: 0
3: 12
4: 130
Right 1023761864 7:43471705-43471727 GGAGGCAGTCACCATCAGAGAGG 0: 1
1: 0
2: 1
3: 14
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023761864 Original CRISPR GGAGGCAGTCACCATCAGAG AGG Intronic
904093508 1:27960716-27960738 GGAGGTAGTCACCCTGAGACAGG + Intronic
904980313 1:34495481-34495503 GGAAACAGTCACCACAAGAGGGG + Intergenic
904993854 1:34615804-34615826 GGAGGAAGTCAGGTTCAGAGTGG - Intergenic
905435566 1:37953004-37953026 AGAGGCTGACACCATCAGAAGGG - Intergenic
906039289 1:42775172-42775194 GGAGGCAGTTCCCATCAGCGTGG - Intronic
907946319 1:59139658-59139680 AGGGGCAGTCACATTCAGAGTGG - Intergenic
908355015 1:63320214-63320236 GGAGGCAGCGACCAGCAGCGTGG + Intergenic
908409321 1:63847068-63847090 GAAGGCAGTCACCATCTGTCAGG - Intronic
912388062 1:109282517-109282539 GGGGGCTGTCACCATCTGACAGG - Exonic
912975840 1:114329505-114329527 GGAGGGAGTGACCCTCAGGGAGG + Intergenic
915268274 1:154733947-154733969 GGAGGCAGACATCTGCAGAGGGG + Intronic
919741001 1:200981605-200981627 AGAGGCAGTTACCAGCAGAAGGG - Intronic
919799554 1:201345191-201345213 GGAGCAAGTCACTATCACAGAGG - Intergenic
923039651 1:230310444-230310466 GGGGACAGTCACCAACACAGAGG - Intergenic
923737818 1:236628095-236628117 GGCAGCAGTCAGCATTAGAGAGG + Intergenic
1063040234 10:2330214-2330236 AAAGGCAGTCAGGATCAGAGAGG + Intergenic
1063210341 10:3875155-3875177 GGAAGCAGTGCCCATCACAGCGG + Intergenic
1065022365 10:21510491-21510513 GGAGGACGCCACCAGCAGAGAGG + Intergenic
1066289040 10:33997349-33997371 GTATGCTGTCACCATCACAGTGG + Intergenic
1067923189 10:50480779-50480801 GGGGGCAGCCACCATCACTGAGG + Intronic
1072258770 10:93646879-93646901 TGACGTAGCCACCATCAGAGAGG + Intronic
1075184542 10:120243878-120243900 GGAGGCTGGCACCCCCAGAGAGG - Intergenic
1077165477 11:1133615-1133637 AGAGGCAGGCAGCATCAGAGGGG + Intergenic
1079492422 11:21003715-21003737 GGAGTCAGAGACCCTCAGAGAGG - Intronic
1081814015 11:45928716-45928738 GGAGGCAGTCACGATAGGTGGGG - Exonic
1084010672 11:66346766-66346788 GAAGGCAGGCACCACCAGCGCGG + Exonic
1084798719 11:71527109-71527131 GGAGGAAGTCACTAGCAAAGAGG + Intergenic
1084806539 11:71583006-71583028 GGAGGAAGTCACTAGCAAAGAGG - Intronic
1085861963 11:80245080-80245102 GGGGGCAGTCACCCTCATGGTGG + Intergenic
1086073517 11:82825040-82825062 GGTTGCAGTCACCATCTCAGAGG - Exonic
1086878972 11:92131883-92131905 AGAGGCAGTTAGCATCAGTGAGG + Intergenic
1087147574 11:94827318-94827340 TGAGGCATCCACCATGAGAGTGG - Intronic
1090615054 11:128506968-128506990 GGAAGAAGTCTCCATCAGACAGG + Intronic
1094488937 12:30946633-30946655 GGGGACAGCCACCTTCAGAGAGG + Intronic
1095956700 12:47810748-47810770 AGAGCAAGTCACCCTCAGAGTGG + Intronic
1096680603 12:53252831-53252853 GTAGGCAGTCACCAGCATGGTGG - Exonic
1102473429 12:113173505-113173527 GGAGGCAGGCACCAACGGAAAGG + Intronic
1104763562 12:131312596-131312618 GGGGGAAGCCACCATCAGGGAGG + Intergenic
1104815940 12:131645481-131645503 GGGGGAAGCCACCATCAGGGAGG - Intergenic
1106387592 13:29302677-29302699 GGAGGCAGCCACCATCTCTGTGG + Intronic
1110024566 13:70519246-70519268 GGAGGCAGTTACCATCAGCACGG + Intergenic
1112577999 13:100653979-100654001 CGATGGAGTCACCACCAGAGTGG - Intronic
1113395407 13:109942869-109942891 GTAGGCAGTCACAATGTGAGAGG + Intergenic
1113856491 13:113449167-113449189 GGAGGCAGCCCCAGTCAGAGAGG + Intronic
1113856500 13:113449201-113449223 GGAGGCAGCCCCAGTCAGAGAGG + Intronic
1113856509 13:113449235-113449257 GGAGGCAGCCCCAGTCAGAGAGG + Intronic
1113869699 13:113551677-113551699 TGAGGAAGTCACTAGCAGAGAGG - Intronic
1114667874 14:24391326-24391348 GGGGGCAGTTAGCTTCAGAGTGG + Intergenic
1116427611 14:44809650-44809672 GGGGGCATTCACCTTTAGAGTGG - Intergenic
1119953430 14:78769785-78769807 GGAGGCAGTAGCCATTTGAGAGG + Intronic
1120295385 14:82633819-82633841 TAAGGCAGACACCACCAGAGCGG - Intergenic
1122902578 14:104787940-104787962 GGAGGCCGCCAGCATCAGGGAGG - Intronic
1122985766 14:105210928-105210950 GGAGGCAGCCAGGGTCAGAGAGG - Intronic
1123168116 14:106346150-106346172 GGAGGCAGACGCCTACAGAGAGG + Intergenic
1124127015 15:26945457-26945479 GGAGGCAGTGAGATTCAGAGAGG + Intronic
1126333102 15:47555263-47555285 GGAGGCAGAGGCCATCACAGAGG - Intronic
1128856677 15:71023827-71023849 AGAGGCAGTCACCATCACTGAGG + Intronic
1129601746 15:77003124-77003146 GGAAACAGCCACCACCAGAGAGG - Intronic
1129917611 15:79288176-79288198 GGAGGCAGTTATCATCAGTCTGG + Intergenic
1130088826 15:80802245-80802267 GGAGGCAGACACCATAAGGCGGG + Intronic
1130305855 15:82711664-82711686 GGAGGCACTCACCCTCAAAGTGG + Intergenic
1130754105 15:86744618-86744640 GGAGACATTCACCCCCAGAGGGG + Intronic
1131508591 15:93036553-93036575 GCAGGCAGGCTCCATCAGAGCGG - Intronic
1132981836 16:2742326-2742348 GGAGGCAGACACCGGCAGTGGGG + Intergenic
1134342509 16:13358067-13358089 GGAGGCCGTACCCATCACAGAGG - Intergenic
1135895865 16:26401900-26401922 GAAGTCAGTTACCACCAGAGAGG + Intergenic
1137037228 16:35577274-35577296 GGAGGCAGTCACCATGCCACTGG + Intergenic
1139827700 16:69770439-69770461 GGAGGATGGCACCCTCAGAGAGG + Intronic
1140462190 16:75148754-75148776 GGCGGCAGTGACCCTCAGGGCGG + Intronic
1140489724 16:75325061-75325083 GGATGCAGTCACCCAAAGAGTGG - Intronic
1143014986 17:3886951-3886973 GGAGGAAGTTACCAGCAGACAGG - Intronic
1143761108 17:9104954-9104976 AGAGGCACTCACCATCACAGGGG - Intronic
1144946400 17:18971649-18971671 GGACGCTGTCAGCAGCAGAGCGG + Exonic
1145318159 17:21747305-21747327 GGAGGCAGACACAGTCAGACAGG - Intergenic
1150010400 17:61497469-61497491 GGATGCAGTTTCCATAAGAGTGG + Intergenic
1152878316 17:82800993-82801015 GGAGGTAGGCACCATGAGGGCGG + Exonic
1155046918 18:22110702-22110724 AGAGGCAGTCAGCAGCGGAGTGG + Intergenic
1155095154 18:22548334-22548356 GGAGGCAGCCTCTATCAGTGAGG + Intergenic
1157067887 18:44373606-44373628 AGAGGCAGCCACCATCTGTGTGG - Intergenic
1157381889 18:47226053-47226075 GAAGGCCGTCACCAGCAGGGTGG - Intronic
1159929982 18:74300751-74300773 TGAGGCAGTTACCAACATAGTGG - Intergenic
1159987888 18:74866485-74866507 ACACACAGTCACCATCAGAGAGG + Intronic
1161086650 19:2338597-2338619 GGAGGCTGTCAGCTGCAGAGGGG + Intronic
1161678986 19:5669585-5669607 GGAAGCAGTGTCCAGCAGAGAGG + Intergenic
1161753400 19:6113923-6113945 GGAAGAAGTCACGATCAGACTGG + Intronic
1164540552 19:29118638-29118660 GAAAGCAGTGAGCATCAGAGTGG + Intergenic
1164575596 19:29403701-29403723 GGAGGCAGTCCTTCTCAGAGTGG + Intergenic
1166899107 19:46044518-46044540 GGGGGCAGTCACCATCTCTGTGG + Intronic
1167214308 19:48154290-48154312 GGAGGCAGTTAAGATCTGAGGGG - Intronic
934656775 2:96120488-96120510 AGGGGCAGTGACCATAAGAGGGG - Intergenic
934735832 2:96689388-96689410 GGGGGCAGGCCCCACCAGAGGGG + Intergenic
937451980 2:122009659-122009681 GGAAGCAGGCACCATCAGAGGGG - Intergenic
937651700 2:124326539-124326561 GGAGGCAGATTCCTTCAGAGAGG + Intronic
939364933 2:141219214-141219236 AGAGGCAGCCACCATCACTGAGG + Intronic
939562205 2:143745350-143745372 GCAGGCAGCCACCATCAGCCAGG + Intronic
942807859 2:179955099-179955121 GCAGGCAGTCACTATCATACTGG - Intronic
946419058 2:219554690-219554712 GGAGGACGTGACCATCAGTGAGG - Exonic
947677553 2:231996972-231996994 GGAGGCAGTGGCCAACAGGGTGG - Intronic
948718936 2:239883921-239883943 GCTGGCAGTCACCAGGAGAGAGG + Intergenic
1170817689 20:19728646-19728668 GGAGGCTGCCTCCATCACAGAGG - Intergenic
1171018345 20:21561818-21561840 GGAGGCAGCCTCCAGAAGAGAGG + Intergenic
1171411527 20:24951390-24951412 GGGGGCTGTCACCAGCACAGTGG - Intronic
1172480245 20:35267262-35267284 GGATCCACTCACCATCGGAGAGG + Exonic
1172640023 20:36435388-36435410 GGTGGCAGTAACCAACCGAGGGG - Intronic
1173434969 20:43024165-43024187 AGAGGAAGCCACCCTCAGAGAGG - Intronic
1173837942 20:46138119-46138141 AGAGGCAGTCACCAGCTGAGTGG - Intergenic
1174186885 20:48712452-48712474 GGTGGCAGTGCCCATCAGAGGGG - Intronic
1175702369 20:61149204-61149226 TGTGGCAGACTCCATCAGAGAGG + Intergenic
1176927954 21:14773132-14773154 GAAGACAATCACTATCAGAGGGG - Intergenic
1180246869 21:46554407-46554429 GGAGGCAGACACATGCAGAGAGG - Intronic
1181315056 22:21965408-21965430 GGAGGAAGACACCACCATAGAGG + Intronic
1183317070 22:37142644-37142666 GGAGGCAGTGCCCCTCACAGTGG - Intronic
1184152240 22:42645944-42645966 GGAGACAGACACCGGCAGAGAGG + Intronic
1185067977 22:48641504-48641526 AGGGGCAGCCACCATCAGAATGG - Intronic
1185126240 22:49012296-49012318 GGAGGCAGCCACCGTCAGGATGG + Intergenic
950378689 3:12593069-12593091 GGAGGAAGGCTCCAACAGAGAGG - Intronic
952751306 3:36827131-36827153 GTGGGCAGTAACCATCAGAGAGG + Exonic
953145301 3:40269497-40269519 GGAGTCAGGGACCATCATAGAGG - Intergenic
954369843 3:50164411-50164433 GGAGACAGTGAGCCTCAGAGTGG + Intronic
954380665 3:50217358-50217380 GGAGGCATACACCATGGGAGGGG + Intronic
955532286 3:59886648-59886670 GGAGTAACTCACCAACAGAGAGG + Intronic
960388233 3:117047004-117047026 GGAGGCAAAAACCATCATAGAGG + Intronic
963397938 3:144757208-144757230 GGGGGCAGTGCCCATCAGGGAGG - Intergenic
965342829 3:167511724-167511746 AGGGGCAGTCACCATCACTGTGG + Intronic
969158818 4:5237226-5237248 GGAGGGAGGCACCATCTGATTGG + Intronic
972795327 4:42411838-42411860 GGGGGCAGTCACCATAACACTGG + Exonic
974699650 4:65424052-65424074 GGTGGGACTCACCATTAGAGTGG - Intronic
984823687 4:183906128-183906150 GGAGACAGTCTTCATCACAGAGG - Exonic
985245297 4:187974490-187974512 GCAGCCAGACACCATCTGAGGGG - Intergenic
993779008 5:92042110-92042132 GGGGCCTGGCACCATCAGAGTGG - Intergenic
1000085916 5:157887157-157887179 GGGGGCAGTGCCCATCAGGGAGG - Intergenic
1000169191 5:158684996-158685018 AGAGGCATTCACCAGCGGAGGGG + Intergenic
1000184152 5:158842691-158842713 GGTGGCAGTCATCATAAGAATGG + Intronic
1001985986 5:176074798-176074820 GGAGCCAGCCACCCTCATAGAGG + Intronic
1002103379 5:176868313-176868335 GGAGGGTGTCACCAGGAGAGGGG + Intronic
1002230884 5:177763326-177763348 GGAGCCAGCCACCCTCATAGAGG - Intronic
1002264453 5:178020422-178020444 GGAGCCAGCCACCCTCATAGAGG + Intronic
1002318069 5:178357250-178357272 GAAGGAGGTCACCATCTGAGGGG - Intronic
1004314363 6:14572892-14572914 GGGGGCAGTTTCCTTCAGAGTGG + Intergenic
1005087728 6:22024014-22024036 GGATGCATTCACAATCAGGGAGG - Intergenic
1008286122 6:49653237-49653259 GGAGTCATTCAAAATCAGAGTGG - Intergenic
1010566094 6:77416087-77416109 GGAGGCAAACACCAGCAGACTGG + Intergenic
1012255341 6:97025283-97025305 GAATGCAGTCAACATCAGATGGG - Intronic
1013942436 6:115680832-115680854 CGTGGCTGTCACCATGAGAGAGG + Intergenic
1017067161 6:150539661-150539683 GAAGGCATTCATCACCAGAGAGG - Intergenic
1017525816 6:155240640-155240662 GGAGGCGGTCTGCATCAGACAGG - Exonic
1017776388 6:157684237-157684259 GGAGGAAGTTCCCATCACAGGGG - Intergenic
1018943322 6:168326120-168326142 GAAAGCAGACACCAACAGAGAGG - Intergenic
1019030035 6:169002000-169002022 GGAGGCACTACCCACCAGAGAGG + Intergenic
1019611927 7:1941061-1941083 GGAGGTAGTGACCATCCTAGAGG + Intronic
1023761864 7:43471705-43471727 GGAGGCAGTCACCATCAGAGAGG + Intronic
1025018813 7:55464555-55464577 GGAGGCAGTCACCAGAACAAAGG - Intronic
1026376927 7:69761193-69761215 TGAGGCAGTCTCTATTAGAGCGG - Intronic
1032820854 7:135523129-135523151 AAAGACAGTCACCATCAGATTGG - Intergenic
1034304600 7:150038949-150038971 GGAGGCACCCACCACAAGAGTGG - Intergenic
1037832059 8:22195577-22195599 GGGGGCACTCACCCTCACAGCGG - Exonic
1038275571 8:26118071-26118093 CCAGGTGGTCACCATCAGAGAGG - Intergenic
1038484103 8:27921514-27921536 GGAGGAAGACCCCATCAGAAGGG + Intronic
1039361941 8:36885967-36885989 GGAGGCTGTGACCATCAGCATGG - Intronic
1039798425 8:40934554-40934576 GGAGGCAGTGACTTTCTGAGAGG + Intergenic
1041623596 8:60000175-60000197 GGAGGCAGCGTCCATCAGAGAGG - Intergenic
1045002243 8:97888375-97888397 GGATGCATTCACCACCAGTGAGG - Intronic
1045317171 8:101053158-101053180 AGAGGCAGGCAGCATCAGAGAGG - Intergenic
1047762311 8:127963256-127963278 GCAGGCAGTCACCAACATGGTGG - Intergenic
1049463580 8:142741081-142741103 GGAGCCAGGCCCCGTCAGAGAGG + Exonic
1049881504 8:145067410-145067432 AGAGGGAGACAACATCAGAGAGG - Intergenic
1051778304 9:20659863-20659885 TAAGGCAGTGACCATCGGAGTGG + Intronic
1053122742 9:35558703-35558725 GGAGGCAGTGACCTACTGAGAGG - Intronic
1054743651 9:68833296-68833318 GGAGGCAGTCAAGATAAGAGTGG + Intronic
1056516270 9:87353336-87353358 GAAGGCAGTCACCCTCAAGGCGG + Intergenic
1057241700 9:93417139-93417161 TTAGGCAGTCTCCAGCAGAGTGG + Intergenic
1057430873 9:94992682-94992704 AGAGGCAGTGAGCCTCAGAGAGG - Intronic
1059347085 9:113636369-113636391 GGAGCCAGACGCAATCAGAGTGG - Intergenic
1061617935 9:131792406-131792428 GGTGACAGTTACCATCACAGTGG - Intergenic
1061879868 9:133563201-133563223 GGTGGCAGCCACCCTCAGAACGG - Intronic
1061990547 9:134156385-134156407 CGAGGCAGCCACCAGCAGGGTGG + Intronic
1062206662 9:135341416-135341438 GGAAGCCGTCATCAGCAGAGAGG + Intergenic
1188981285 X:36729480-36729502 GGATGCAGCCACTCTCAGAGAGG - Intergenic
1192185578 X:68944576-68944598 ATAGGCTGTCACCATCAGAATGG + Intergenic
1197704073 X:129621450-129621472 GGAGGCCTTCAACATGAGAGAGG - Intergenic
1198958335 X:142156584-142156606 AGAGGCAGACACCATCACTGCGG + Intergenic
1199419802 X:147631827-147631849 GGATACAGACACCAACAGAGGGG - Intergenic
1201969434 Y:19775185-19775207 GCAGGCAGTCACCTTCAGTGGGG - Intergenic