ID: 1023762642

View in Genome Browser
Species Human (GRCh38)
Location 7:43480903-43480925
Sequence CAGGACTCCTTCTGAAAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 310}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023762642_1023762645 24 Left 1023762642 7:43480903-43480925 CCACTTTTTCAGAAGGAGTCCTG 0: 1
1: 0
2: 4
3: 31
4: 310
Right 1023762645 7:43480950-43480972 TTTCCAACCAGTGGCACTCATGG 0: 1
1: 0
2: 0
3: 12
4: 120
1023762642_1023762644 15 Left 1023762642 7:43480903-43480925 CCACTTTTTCAGAAGGAGTCCTG 0: 1
1: 0
2: 4
3: 31
4: 310
Right 1023762644 7:43480941-43480963 ACATAACTATTTCCAACCAGTGG 0: 1
1: 0
2: 0
3: 7
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023762642 Original CRISPR CAGGACTCCTTCTGAAAAAG TGG (reversed) Intronic
900487369 1:2929646-2929668 CTGGAGTCCTTATTAAAAAGGGG - Intergenic
901866792 1:12111751-12111773 CAGGACTCCCTCTGAAAGGCTGG + Intronic
903973347 1:27133496-27133518 CAGGACTTCATCTGACTAAGAGG + Intronic
905574838 1:39035784-39035806 CAAGGCTCCATCTCAAAAAGTGG - Intergenic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
907564722 1:55424175-55424197 CAAGACCCTTTCTGAAATAGGGG - Intergenic
908302743 1:62778407-62778429 CAGGACTCCTTCTGGAATGTGGG - Intergenic
908888350 1:68815760-68815782 CAGGACCCAGTCTGAAAAACAGG - Intergenic
910246553 1:85144666-85144688 CAGGAGTTCTTCTGAAAGGGAGG - Intergenic
911584020 1:99669487-99669509 CAGGACTCCTTCAGAGATAAGGG - Intronic
912820369 1:112862919-112862941 CAGGACCCTTTCTAAAATAGGGG - Intergenic
913675889 1:121139800-121139822 CAGGACTCCTTCTGAATTGGGGG - Intergenic
914027785 1:143927740-143927762 CAGGACTCCTTCTGAATTGGGGG - Intergenic
914773056 1:150708799-150708821 CAGGATTCATTCTGAAACTGCGG - Intronic
915189376 1:154135889-154135911 CGGGTCTCATTCTGAGAAAGTGG - Exonic
916173146 1:162016457-162016479 CAATATTCCTTATGAAAAAGTGG - Intronic
916531535 1:165661037-165661059 CAGGACCCCTTCTGAAATGAAGG + Intronic
916866534 1:168865742-168865764 GAGGACTGAGTCTGAAAAAGGGG + Intergenic
916871940 1:168924952-168924974 CAGGCCTTTTTCTGAAAATGTGG + Intergenic
916954311 1:169815777-169815799 GAGGACTCCATCTTGAAAAGGGG - Intronic
917148982 1:171924908-171924930 CGAGACTCCATCTCAAAAAGGGG - Intronic
917293692 1:173496302-173496324 CTGGACTCCTTGGGAAAAATAGG + Intergenic
918509981 1:185301374-185301396 CAACACTCCTTCTTAAAAATAGG + Intronic
918737355 1:188082270-188082292 CACAAATCCTTCTGAAAAATAGG - Intergenic
919588198 1:199465339-199465361 CAGGACCCCTTCTGAAATAGGGG + Intergenic
919978664 1:202628929-202628951 CAGCACTCCGTCTGCAAAATGGG + Intronic
920463257 1:206158637-206158659 CAGGACTCCTTCTGAATTGGGGG - Intergenic
920667229 1:207971992-207972014 GAGGGCAGCTTCTGAAAAAGTGG - Intergenic
920753138 1:208701268-208701290 CAAGACTCCATCTCAAAAACAGG + Intergenic
921230304 1:213063771-213063793 CAACATTCCTTCTTAAAAAGAGG + Intronic
921525304 1:216210033-216210055 CAGGACTCCTTCTAAAATGAGGG - Intronic
921721284 1:218474542-218474564 CAGGAAACATTCTGGAAAAGTGG - Intergenic
923228462 1:231961302-231961324 CAGGACTCCTTCTGAAATGAGGG + Intronic
923746445 1:236704967-236704989 CAGGACTCCTTCTGAAATGAGGG + Intronic
1063244303 10:4202593-4202615 CAGGATTCTTGCTGAAAAGGAGG + Intergenic
1063899385 10:10716527-10716549 CAAGACTCAGTCTCAAAAAGGGG + Intergenic
1064081194 10:12309197-12309219 GGGGACTCCTTCTGAGACAGCGG + Intergenic
1064728034 10:18301074-18301096 CACCACTCCTTTTCAAAAAGGGG + Intronic
1064979154 10:21148957-21148979 CAGGACCCCTTCTGAAATGGGGG - Intronic
1065036073 10:21639769-21639791 CAGAACCCCTTCTGAAATGGGGG + Intronic
1065042228 10:21709247-21709269 CAAGACTCCATCTCAAAAAAAGG - Intronic
1065211269 10:23405615-23405637 CAGGACACCTTCTGAAAGCCAGG - Intergenic
1065768426 10:29053808-29053830 CAGGACCCCTTCTGAAATGGAGG + Intergenic
1068637746 10:59366569-59366591 CAGGCTTCCTTGTGAAAGAGAGG + Intergenic
1069285917 10:66715112-66715134 CAGAAATCATTCTGAAAAAGGGG - Intronic
1069474047 10:68717578-68717600 CAAGACTCCTTCTAAGAAAAGGG - Intergenic
1070999353 10:80815628-80815650 CAAGACTCCATCTCAAAAAAAGG - Intergenic
1071412163 10:85407454-85407476 CATGATTCCTGCTGAAAGAGGGG - Intergenic
1071849716 10:89556632-89556654 CAGGAACCCTTCTGAAATGGAGG - Intronic
1072424167 10:95315337-95315359 CTGGGTTCCTTCTGAAAAACAGG - Intronic
1075168345 10:120089992-120090014 CAAGACTCCATCTCAAAAAAAGG - Intergenic
1075932061 10:126307363-126307385 CAAGACTCCATCTCAAAAAAAGG - Intronic
1078677228 11:13433309-13433331 CAGGACACCTTCTGAAATGAGGG - Intronic
1078692959 11:13600512-13600534 CAAGACTCTGTCTCAAAAAGAGG - Intergenic
1079207921 11:18433372-18433394 CAAGACTCCATCTCAAAAAAAGG + Intronic
1079835146 11:25324510-25324532 CAGGTCTCCATCTGCAAAATGGG - Intergenic
1080271012 11:30450831-30450853 TATTACTTCTTCTGAAAAAGGGG - Intronic
1083076228 11:60041872-60041894 CAAAACTCCGTCTGAAAAACAGG + Intronic
1083285122 11:61653696-61653718 CAGGACCCTTTCTGGAATAGGGG - Intergenic
1083679696 11:64345429-64345451 CAGGCATCCTTCTGTAAAACAGG + Intronic
1085849359 11:80101656-80101678 AAGGAATGCTTCAGAAAAAGTGG + Intergenic
1087393133 11:97564957-97564979 CAAGACTCCATCTCAAAAAAAGG - Intergenic
1090033765 11:123230443-123230465 CATTACTCCATCTGTAAAAGGGG + Intergenic
1091287374 11:134415181-134415203 CAAAACTCCTGCTGAAAGAGAGG - Intergenic
1093868961 12:24263211-24263233 CAAGACTCCATCTTAAAAAAAGG + Intergenic
1093904238 12:24671165-24671187 AAGGACATTTTCTGAAAAAGAGG + Intergenic
1094743229 12:33313732-33313754 CAGGACTCCTTCTGGAATGAAGG + Intergenic
1095386340 12:41654986-41655008 CAGGAGTCCTTATGAGAAAGAGG - Intergenic
1095704567 12:45222775-45222797 CAGGATCCCTTCTGAAATGGGGG - Intronic
1095784475 12:46094449-46094471 CAGGACTCCTGCTGAATCTGTGG + Intergenic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1098825134 12:75287377-75287399 CAGGACCCCTTCTGAAATGGGGG - Intronic
1098873873 12:75846603-75846625 CAGGCATCCTTATGAAAGAGAGG - Intergenic
1099854178 12:88142577-88142599 CTGGTCCCATTCTGAAAAAGTGG + Intronic
1101401088 12:104387558-104387580 CAGAACACCTTCTCCAAAAGTGG - Intergenic
1102163513 12:110787964-110787986 CAGGACCCCTTCTGAAATGAGGG + Intergenic
1102617406 12:114166538-114166560 AAGGACTCCTTCTGACCTAGAGG + Intergenic
1102963710 12:117110914-117110936 TAGGATTCCTTGTGTAAAAGGGG + Intergenic
1102965389 12:117121384-117121406 CAAGACTCCATCTCAAAAAGTGG + Intergenic
1103005173 12:117415127-117415149 TAGGACTGCATTTGAAAAAGGGG - Intronic
1104011959 12:124937464-124937486 CTAGACTCCCTCTCAAAAAGAGG + Intergenic
1104439570 12:128783854-128783876 CAAGACTCCCTCTCAAAAAGAGG - Intergenic
1104702335 12:130916443-130916465 CAGCTCACCTTCTCAAAAAGGGG + Intergenic
1105007251 12:132729337-132729359 CAAGACTCCATCTGAAAGAAAGG + Intronic
1105344141 13:19558642-19558664 CAGTAGCCCTTCTGAAAAACAGG + Intergenic
1105535892 13:21262941-21262963 CAGTAGCCCTTCTGAAAAACAGG - Intergenic
1105896564 13:24721384-24721406 CAAGACTCCATCTAAAAAAATGG + Intergenic
1106066711 13:26359559-26359581 CTGAACTGTTTCTGAAAAAGTGG + Intronic
1106457717 13:29941983-29942005 CAGGACTCATGATGGAAAAGAGG + Intergenic
1106487667 13:30186788-30186810 CATGACACCATTTGAAAAAGTGG - Intergenic
1108786578 13:53910119-53910141 CTGGAATCCTTCTGAAATGGGGG + Intergenic
1109180637 13:59210302-59210324 CAAGACTCCGTCTCAAAAAAAGG + Intergenic
1109295341 13:60524112-60524134 CATGATGCCTTCTCAAAAAGGGG + Intronic
1110136287 13:72071402-72071424 AAGGTCTCCTTTTGAAAATGGGG - Intergenic
1110443263 13:75549026-75549048 CAGAAGTCTTCCTGAAAAAGTGG - Intronic
1111286487 13:86099910-86099932 TAGGACCCCTTCTGAAAATGGGG + Intergenic
1113325527 13:109277753-109277775 CAGGGTTCCTTCTGAAGAACAGG - Intergenic
1114191765 14:20444823-20444845 CAAGACTCTTTCTCAAAAAAAGG - Intergenic
1115112695 14:29842808-29842830 CAGGAGTCTTTCAGAAAAAGCGG - Intronic
1115196436 14:30805363-30805385 CAGGACTCCTTCAGAAGCAAGGG - Intergenic
1115545644 14:34462656-34462678 CAGGCATCCTTCTGAGAAGGAGG + Intronic
1115601959 14:34963596-34963618 CACGATACCTGCTGAAAAAGAGG + Intergenic
1116382638 14:44290251-44290273 CAAGACTCCTTCTGGAATAAGGG - Intergenic
1117611066 14:57484087-57484109 AAGGACTCCACCTGAAAAACAGG + Intronic
1117806793 14:59501246-59501268 CATGTCTGCTTCTGAAATAGAGG + Exonic
1119686534 14:76637157-76637179 CTGGATTCCTTTTTAAAAAGAGG - Intergenic
1120192723 14:81453879-81453901 CAAGACTCCATCTCAAAAAAAGG - Intergenic
1121047822 14:90800797-90800819 CAAGACTCCGTCTCAAAAAAAGG + Intronic
1122226722 14:100285024-100285046 CGAGACTCCGTCTAAAAAAGCGG + Intergenic
1126022373 15:44414982-44415004 CAGTAGCCCTTCTGAAAAACAGG - Exonic
1127039332 15:54956190-54956212 CAGGCCTTCTTGTGAAAAGGAGG + Intergenic
1127458045 15:59172343-59172365 CAAGACTCCGTCTCAAAAAAAGG + Intronic
1127475207 15:59326508-59326530 CAAGACTCCATCTCAAAAAAAGG + Intronic
1128179258 15:65587214-65587236 CATAACTCCTCCTGAAAAAAAGG - Intronic
1128543053 15:68550358-68550380 CAGGACCCCTTCTGAAAGCCAGG + Intergenic
1128987856 15:72234378-72234400 CAGGACCCCTTCTGAAATGGGGG - Intergenic
1130828986 15:87580343-87580365 CAAGACTCCATCTCAAAAAAAGG + Intergenic
1130972050 15:88741328-88741350 CAGGACTCCTTCTGGTGAAAGGG + Intergenic
1132008082 15:98249128-98249150 CAGGCGTCCATCTGCAAAAGTGG + Intergenic
1133778053 16:8913342-8913364 CGAGACTCCCTCTCAAAAAGAGG + Intronic
1134215994 16:12317299-12317321 CAGGACTCAGTCTGAACAGGTGG + Intronic
1134221530 16:12358625-12358647 CTGGACCCCTTCTGAAATGGGGG - Intronic
1135015579 16:18922475-18922497 CAAGACTCCTTCTCAAAGAATGG - Intronic
1135083079 16:19452784-19452806 CAGGACCCCTTCTGAAATGAGGG + Intronic
1135461918 16:22651846-22651868 CAGGAGTCTCTCTGAAAAGGAGG - Intergenic
1136227644 16:28869627-28869649 CAGGACGCTGACTGAAAAAGTGG - Intronic
1138266533 16:55663891-55663913 CAGGACTCCTTCTGAAATGGGGG - Intronic
1139058112 16:63212430-63212452 CAGGACATCTTCAAAAAAAGTGG + Intergenic
1139445257 16:66994087-66994109 CAAGACTCCATCTCAAAAAAAGG + Intronic
1141910625 16:87056356-87056378 CAGGACTCAGACTGAGAAAGGGG + Intergenic
1142640937 17:1285703-1285725 CAAGACTCCATCTAAAAAATGGG + Intronic
1143328689 17:6118597-6118619 CAGGTCTCATTCTATAAAAGAGG - Intronic
1143378664 17:6482162-6482184 CAGGACTCCTTCTGAAATGAGGG - Intronic
1143638690 17:8182512-8182534 CAAGACTCCTTCAAAAAGAGGGG + Intergenic
1143718882 17:8796574-8796596 CAAGACTCCATCTCAAAAAAAGG - Intergenic
1144523199 17:15967999-15968021 CAGGACCCCTTCTGAAATGCGGG + Intronic
1144734310 17:17546422-17546444 CAAGCCTGCTTCTGAAAATGTGG - Intronic
1146072370 17:29694655-29694677 CAAGACTCCGTCTCACAAAGAGG + Intronic
1146563060 17:33888404-33888426 CAGGACTTCTTCTGCTTAAGTGG + Intronic
1146860069 17:36289686-36289708 CAGGATGCCTTCTGAAATGGGGG - Intronic
1147090395 17:38093777-38093799 CAGGATGCCTTCTGAAATGGGGG - Intergenic
1147106818 17:38226749-38226771 CAGGATGCCTTCTGAAATGGGGG + Intergenic
1147116998 17:38308146-38308168 CTAGACTCCGTCTCAAAAAGGGG - Intronic
1147606228 17:41775306-41775328 CAGAACTCCTCCTGAGGAAGGGG + Intronic
1147904781 17:43815924-43815946 CAGGAGTCCTTCTGGAGCAGTGG - Intronic
1148079211 17:44958427-44958449 CAAGACTCCATCTCAAAAAAAGG - Intergenic
1148412679 17:47481453-47481475 CTAGACTCCATCTCAAAAAGGGG + Intergenic
1148422713 17:47561787-47561809 CAGGATGCCTTCTGAAATGGGGG - Intronic
1149569833 17:57664504-57664526 CAAGACTCCCTCTCAAAAAAGGG + Intronic
1149962855 17:61131042-61131064 CAAGACTCTGTCTCAAAAAGGGG + Intronic
1151054691 17:71017803-71017825 CAGGACCCCTTCTGAAATGGGGG + Intergenic
1151421407 17:74000485-74000507 CAGGACCTCTTCTGAAATGGGGG + Intergenic
1151641717 17:75400183-75400205 CAAGACTCCATCTCAAAAAAAGG - Intronic
1152179494 17:78809856-78809878 CGGGACTCCATCTCAAAAAAAGG - Intronic
1153230145 18:2927234-2927256 CCCAACACCTTCTGAAAAAGAGG - Intronic
1153995018 18:10433281-10433303 GTGGTCTCCTTCTGAAAAAGAGG + Intergenic
1155133508 18:22963109-22963131 AATGACTGCTTCTGAAGAAGGGG - Intronic
1156585456 18:38426442-38426464 CAGGCCTCCTTTTGATAAAATGG - Intergenic
1157410730 18:47460760-47460782 CAGGACTCCTTGGCAAAAATTGG + Intergenic
1159302786 18:66597358-66597380 AAGGACTCCTTTTAAATAAGTGG + Intronic
1164884092 19:31762062-31762084 CGAGACTCCTTCTCAAAAAAAGG - Intergenic
1164885427 19:31774569-31774591 GGGGACTCCTTCTGCAAATGGGG - Intergenic
1165209722 19:34224317-34224339 CAAGACTCCGTCTCAAAAAAAGG + Intronic
1166312827 19:41972750-41972772 CAAGACTCCATCAAAAAAAGGGG + Intronic
1167300015 19:48672778-48672800 CTGGACTCTTTCTTAAAGAGGGG - Intronic
925959497 2:9002870-9002892 CAGGATTCTTGCTGACAAAGTGG - Intronic
927420394 2:22925019-22925041 CAAGACTCCATCTCAAAAAAAGG - Intergenic
927796778 2:26056209-26056231 CAAGACTCCATCTCAAAAAAAGG - Intronic
927830224 2:26343750-26343772 CAGTACTCTTTTTCAAAAAGAGG - Intronic
928425238 2:31172380-31172402 CAGGACTCTACCTGAACAAGAGG - Intergenic
928438982 2:31275630-31275652 CAGGACTTCTCCTGTGAAAGTGG + Intergenic
935353553 2:102177251-102177273 CAAGACTCCGTCTCAAAAAAAGG + Exonic
937415125 2:121708595-121708617 CAAGACTCCTTCAAAAAAACAGG - Intergenic
938555924 2:132424274-132424296 GAGGACCCCTTGTTAAAAAGTGG - Intronic
939162895 2:138610326-138610348 CAGGGCTCCTTCTGAGATGGGGG - Intergenic
939769127 2:146292631-146292653 CAAGACTCCATCTCAAAAAAAGG - Intergenic
940549827 2:155139912-155139934 CAGAACCCCTTCTGAAATGGTGG - Intergenic
940550168 2:155144134-155144156 CAGGACTTTTTCTGGAAATGGGG + Intergenic
943385277 2:187196035-187196057 TAGGACTCCTTTTCAAAATGTGG - Intergenic
944732744 2:202533809-202533831 CAAGACTCCGTCTCAAAAAAAGG + Intronic
945734541 2:213582878-213582900 CAGTACTGCTTCAGAAAATGAGG - Intronic
948998832 2:241600182-241600204 CAAGACTCCTTCTCAAAAAAAGG + Intronic
949007287 2:241656823-241656845 CGAGACTCCGTCTCAAAAAGAGG - Intronic
1168782917 20:509896-509918 CAGGAAACATTCAGAAAAAGAGG + Intronic
1168920068 20:1524973-1524995 CAAGACTCCATCTCAAAAAAAGG + Intergenic
1169099885 20:2938194-2938216 CAAGACTCCGTCTCAAAAAAAGG - Intronic
1169221046 20:3823258-3823280 CAAGACTCCATCTCAAAAAAAGG - Intronic
1169350025 20:4861031-4861053 CAAGACTCCATCTCAAAAAAAGG + Intronic
1169697615 20:8408408-8408430 CAAGACCCCTTCTTAAAAAAAGG + Intronic
1170207436 20:13813677-13813699 CAGGAATGCTTTTGCAAAAGAGG + Intronic
1172063712 20:32205205-32205227 CAGGCCTCATGCGGAAAAAGAGG - Intronic
1172775963 20:37407135-37407157 CAAGACTCCATCTCAAAAAAAGG - Intergenic
1172805337 20:37607788-37607810 CAAGACTCCATCTCAAAAAAAGG + Intergenic
1173641327 20:44604212-44604234 CAGGATGCCTTCTTAAAGAGAGG + Intronic
1178245874 21:30951486-30951508 CAGGACCCCTTCTAAAATGGGGG + Intergenic
1179198589 21:39191212-39191234 CAGGAGCCCTGCTGGAAAAGGGG - Intronic
1179507864 21:41853688-41853710 TAGCATTCCTGCTGAAAAAGCGG - Intronic
1180027073 21:45171950-45171972 CAGGACTCCACATGAAACAGTGG - Intronic
1180755802 22:18160315-18160337 CAAGACTCCATCTCAAAAAAAGG - Intronic
1182322643 22:29488369-29488391 CAAGACTCCGTCTCAAAAAAAGG + Intronic
1183398436 22:37586829-37586851 CAGGACCCCTTCTGAAATGAGGG - Intergenic
1183852739 22:40604732-40604754 CAAGACTCCATCTCAAAAAAAGG + Intronic
1183856853 22:40640445-40640467 CAGGACTCCATCTTAAATAGGGG + Intergenic
1184361428 22:44021249-44021271 CTGGACTCCTCCTGAAATGGGGG + Intronic
1184688655 22:46107678-46107700 CAGGAAGCCTCCTGAGAAAGGGG + Intronic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
951560166 3:23958340-23958362 AATGACTACTTCTTAAAAAGTGG - Intronic
951723273 3:25725052-25725074 CAGGACATTTTCTGAAATAGGGG - Intronic
951967912 3:28408623-28408645 GAGGTCTCCTGCTGAAAAGGTGG - Intronic
952444575 3:33368604-33368626 CAAGACTCCATCTAAAAAAAAGG - Intronic
952817581 3:37458992-37459014 TAGGACTCCTTCTGGCAAAAAGG - Intronic
953278780 3:41531427-41531449 CAAGACTCCGTCTCAAAAAGAGG + Intronic
955483039 3:59408602-59408624 CAGGGATCCCTCTGAAAAATAGG - Intergenic
956514797 3:70034830-70034852 CAAGACTCCATCTCAAAAAAAGG + Intergenic
957661846 3:83166541-83166563 CAGAACTCCTTTTCAAACAGTGG - Intergenic
958973607 3:100640531-100640553 CAAGACTCCGTCTCAAAAAAAGG - Intronic
959559548 3:107764002-107764024 CAAGACTCCATCTCAAAAAACGG - Intronic
960829431 3:121830826-121830848 CAAGACCCATTCTGAAACAGGGG - Intronic
963373357 3:144430922-144430944 CAGAACTGCCTCTGAAAAAGTGG + Intergenic
963842745 3:150124266-150124288 CAGGACTCGCTCTGACAGAGAGG - Intergenic
964519881 3:157553622-157553644 CAGGACCCCTTCTGAAATGAGGG - Intronic
964668505 3:159199963-159199985 CAGTTTTCCTTCTGAAAAATAGG + Intronic
965072192 3:163928315-163928337 TAGGACTACTTCTGACAAACAGG - Intergenic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
965948936 3:174280029-174280051 CAGGTCTCCTTCTTGTAAAGTGG - Intronic
966427499 3:179795175-179795197 CAGAACTCCTTCTGATCAAATGG - Exonic
968513770 4:1007183-1007205 CAAGACTCCGTCTCAAAAAAAGG - Intergenic
968600683 4:1507886-1507908 CAGGAGTCCATGTGGAAAAGTGG - Intergenic
969420078 4:7088923-7088945 CTGGACTCCTTGAGAAAAACAGG - Intergenic
969996136 4:11315214-11315236 CAAGACTCCATCTAAAAAAAAGG + Intergenic
970385401 4:15550907-15550929 AAGGGCTCCTACTGAAGAAGTGG + Exonic
970923667 4:21424557-21424579 CAAGACTCTGTCTGAAAAAGAGG + Intronic
972507754 4:39736449-39736471 CAAGACTCCGTCTCAAAAAAAGG + Intronic
972818986 4:42677212-42677234 CTGGACTCCTTGGGAAAAATGGG + Intergenic
975127056 4:70794566-70794588 CAAGACTCCATCTCAAAAAAAGG + Intronic
976657917 4:87508546-87508568 CAGAACCCCTTCTGAAATGGGGG + Intronic
979797380 4:124863218-124863240 CAGTTCTCCTTCTGAACAAATGG + Intergenic
981930143 4:150180921-150180943 CAGGACTCTTTCTGGAATGGGGG - Intronic
982864221 4:160489884-160489906 TTGGACTCCTTGTGAAAAACAGG + Intergenic
982865484 4:160505324-160505346 CAGGACCCCTCCTGAAATGGGGG - Intergenic
983684211 4:170388877-170388899 CAAGACTCCGTCTCAAAAGGGGG - Intergenic
983983079 4:174023374-174023396 CAAGACTCCATCTCAAAAAAAGG + Intergenic
984153285 4:176161428-176161450 CAGGATTTCTTCTTTAAAAGAGG - Intronic
987953744 5:24710570-24710592 AAGGCCTCCTTCTGAAAATTAGG - Intergenic
990665270 5:58064967-58064989 CAGGACCCCTTTTGTAAATGGGG - Intergenic
991030064 5:62073402-62073424 CTAGACTCCTTATGCAAAAGGGG - Intergenic
991034480 5:62114386-62114408 AAGGCCGACTTCTGAAAAAGTGG + Intergenic
993627680 5:90245394-90245416 GAGGTCTCCATCTGAAAAACAGG - Intergenic
993715118 5:91268714-91268736 CATGACTTCTTCTGAAAAGCAGG - Intergenic
993735318 5:91469388-91469410 CAGGACCCTTTCTGAAAGAACGG - Intergenic
994260659 5:97654965-97654987 CTGGACTGGTTCTGAAAAAGAGG - Intergenic
995730024 5:115229048-115229070 CAGGACTACTTTTTAGAAAGAGG + Intronic
997097044 5:130924507-130924529 CAAGACTCCATCTGAAAAAATGG + Intergenic
997146680 5:131441945-131441967 AAAGACCCCTTCTGAAAACGTGG - Intronic
997246925 5:132357488-132357510 CAAGACTCCATCTCAAAAAAAGG + Intergenic
997872877 5:137520627-137520649 CAAGACTCCATCTCAAAAAAAGG - Intronic
997926742 5:138037217-138037239 CAAGACTCCTTCTGGAGATGAGG + Intronic
998157397 5:139794909-139794931 CAGGACTCTAACTGAAGAAGAGG - Intergenic
1007841076 6:44716105-44716127 CAGGTTTCATTCTGAAAAGGTGG - Intergenic
1007903733 6:45437798-45437820 CAGGACTCCTTCTTCTAAATTGG - Intronic
1008010307 6:46460067-46460089 CAAGACCCTCTCTGAAAAAGTGG - Intronic
1008461139 6:51773926-51773948 CAGGACACGTCCTGAAAATGGGG - Intronic
1008610065 6:53177527-53177549 CAAGACTCTATCTGAAAAAAAGG - Intergenic
1011047313 6:83098936-83098958 CAGGACCCCTTCTGAAATAGGGG + Intronic
1013527608 6:110989463-110989485 CAGGACTCCGTCTCAAAAGAAGG - Intronic
1013581385 6:111538223-111538245 AGGGACTCCCTCTGAAAAATCGG - Intergenic
1014249317 6:119099504-119099526 CAGGACCCCTTTTGAAATGGGGG - Intronic
1014650819 6:124034944-124034966 CAAGCCTCCTTCTAAACAAGTGG - Intronic
1015214856 6:130737803-130737825 CAGGACCCTTTCTCAAAATGTGG + Intergenic
1016265866 6:142232228-142232250 CAAGACTCCATCTCAAAAAAAGG + Intergenic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017117674 6:150994286-150994308 CAGGAAGCCTCCTGAAAAGGGGG - Intronic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1018195509 6:161353285-161353307 CAGGACTCTTTCTGAAATCCGGG - Intronic
1020147476 7:5655592-5655614 CAAGACTCCATCTCAAAAAAAGG + Intronic
1021398443 7:20180428-20180450 CAAGACTCCATCTAAAAAAAAGG + Intronic
1021653390 7:22852999-22853021 CAGGACTCCCTCTGGAATGGGGG + Intergenic
1021745032 7:23731596-23731618 CAGGACACCTTCTGGAAAAGGGG - Intronic
1022048492 7:26643106-26643128 CGGGACCCCTTCTGAAATGGGGG - Intronic
1022057806 7:26757771-26757793 CAAGACTCCATCTCAAAAAATGG - Intronic
1022359332 7:29643565-29643587 AATGCCTCCTTCTGAAGAAGAGG - Intergenic
1023762642 7:43480903-43480925 CAGGACTCCTTCTGAAAAAGTGG - Intronic
1023951417 7:44848843-44848865 CAGGACTCCATCTCTAAAAAAGG - Intergenic
1024136224 7:46411986-46412008 CAGGACCCCTTCTGAAATAAGGG + Intergenic
1024860188 7:53830017-53830039 CAAGACTCCATCTCAAAAAAAGG + Intergenic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1027953007 7:84843255-84843277 CAGGACTCCGTCTCAAAAAAAGG - Intergenic
1031077642 7:117228186-117228208 CAGGAATACTTTTGAGAAAGAGG - Intronic
1031484908 7:122314340-122314362 CAGGACTGAATCTCAAAAAGTGG - Intergenic
1032431805 7:131868185-131868207 CAGGACCCCTTCTGAAATGAAGG + Intergenic
1033087878 7:138358908-138358930 AAGGACTCCATCTTAAATAGGGG + Intergenic
1033406630 7:141075272-141075294 TATGTCTCCTTCTGAAACAGTGG + Intronic
1033839304 7:145354431-145354453 CAAGACTCCGTCTCAAAAAAAGG + Intergenic
1033987283 7:147241614-147241636 CAAGACTCCGTCTCAAAAAAAGG + Intronic
1034532873 7:151707655-151707677 CAGGACTCCTTCTGGAGATGAGG - Intronic
1034561063 7:151879485-151879507 CAGGACCCCTTCTGAATAGAGGG - Intergenic
1034710743 7:153189449-153189471 CAAGACTCCATCTGAAAGAAAGG - Intergenic
1035164499 7:156977765-156977787 CAAGACTCCATCTCAAAAAAAGG - Intergenic
1035236200 7:157499111-157499133 CAGGAGTCCCTCGGAAATAGTGG + Intergenic
1035433545 7:158840553-158840575 CAAGACTCCGTCTAAAAAAATGG + Intergenic
1036137896 8:6179219-6179241 CAAGACTCCATCTCAAAAAAAGG - Intergenic
1039585921 8:38706911-38706933 CAGGACCCTTTCTGGAAAGGGGG + Intergenic
1041073829 8:54151058-54151080 CAGGACTCCATCTTGAACAGGGG + Intergenic
1041197506 8:55415632-55415654 CAGGAATTCTTCTGTAACAGTGG - Intronic
1042215074 8:66423100-66423122 CAGGACCCCTTCTGGAATAAGGG - Intergenic
1042589749 8:70386074-70386096 CAGGATTCCTTATGGGAAAGAGG + Intronic
1042807090 8:72782668-72782690 CAGGAGTTATTCAGAAAAAGTGG - Intronic
1044032827 8:87259772-87259794 CTGGACTCCTTAGGAAAAACAGG - Intronic
1044247742 8:89969042-89969064 CAGGAGTCCTTCTGACCATGGGG - Intronic
1044581436 8:93829991-93830013 CAGGACCCCTTCTGAAATGGGGG - Intergenic
1045112325 8:98947554-98947576 CAGAACTCCTTTCTAAAAAGGGG + Intronic
1045911609 8:107416742-107416764 CAGAACACCTTCTGAAATAGGGG + Intronic
1046101798 8:109622877-109622899 CAGGCCTTCTTCTGGAAATGTGG - Intronic
1046392850 8:113599843-113599865 CAGAAATCCTTTTGAAACAGAGG - Intergenic
1047573129 8:126122756-126122778 CAGGCCTGCTTCTGGAGAAGTGG + Intergenic
1048359281 8:133682247-133682269 CAGAACTCCATCTTAAAAAAAGG + Intergenic
1048492119 8:134903343-134903365 AGAGACTCCCTCTGAAAAAGTGG - Intergenic
1052384622 9:27808587-27808609 CAGAACTCCCTCTCAACAAGTGG - Intergenic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1052856715 9:33411493-33411515 CGAGACTCCGTCTCAAAAAGGGG - Intergenic
1053087466 9:35238568-35238590 CAAGACTCCATCTCAAAAAAAGG - Intronic
1055676925 9:78672690-78672712 CAGGAATCATGCTGATAAAGTGG + Intergenic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1056424455 9:86463146-86463168 CAAGACTCCATCTGAAAGAAAGG - Intergenic
1057158918 9:92870964-92870986 GAGGACGCCTGCTAAAAAAGAGG + Intronic
1058464510 9:105214281-105214303 CAAGACTCCCTCTCAAAAAAAGG + Intergenic
1058574254 9:106383068-106383090 CAGGAATCCTGCTAAAAAAAGGG - Intergenic
1058962834 9:110007993-110008015 CAGGACCCCTTCTGGAATGGGGG + Intronic
1062485466 9:136772719-136772741 CAAGACTCCGTCTCAAAAAGAGG + Intergenic
1185936497 X:4262633-4262655 CAGGACCCCTTCTGAAATGAGGG + Intergenic
1186584263 X:10855066-10855088 CAGGATACCTTCTAAAGAAGAGG - Intergenic
1188412508 X:29891103-29891125 CTGGCCTCCTCCTGACAAAGGGG + Intronic
1188434408 X:30144257-30144279 CTGGAATTCTTCTGAAAATGTGG - Intergenic
1188908749 X:35820184-35820206 CAAGACTCCGTCTCAAAAAAAGG + Intergenic
1190050151 X:47143662-47143684 TAGGACACCTTCTAAAAAATAGG - Intronic
1190111787 X:47594565-47594587 CAGGACCCCTTCTAAAAGGGAGG - Intronic
1190143549 X:47869705-47869727 CAAGACTCCATCTCAAAAAAAGG - Intronic
1190962784 X:55268819-55268841 CAAGACTCCTTGGGAAAAACAGG + Intronic
1191417632 X:60491908-60491930 GAAGATTCCTTCTGAAACAGCGG + Intergenic
1192980581 X:76335534-76335556 CAGGAGTCCTTCAGCAAGAGGGG - Intergenic
1193112814 X:77746808-77746830 CAAGACTCCATCTCAAAAAAAGG - Intronic
1196520326 X:116664128-116664150 CAAGACTCCATCTCAAAAAAAGG + Intergenic
1197188857 X:123622031-123622053 CAAGACTCCTTCTCGAAAAAAGG + Intronic
1199677669 X:150201372-150201394 CAGGTTTCCTTCTGAAAGACTGG - Intergenic
1201720783 Y:17094534-17094556 CAGGACCCCTTCTGAAATGAGGG + Intergenic