ID: 1023764544

View in Genome Browser
Species Human (GRCh38)
Location 7:43498366-43498388
Sequence TAACCAGATGTTGATCCCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023764539_1023764544 2 Left 1023764539 7:43498341-43498363 CCCGCAGGGAGGGAGGCCAGTGG 0: 1
1: 1
2: 8
3: 56
4: 562
Right 1023764544 7:43498366-43498388 TAACCAGATGTTGATCCCTTGGG No data
1023764541_1023764544 1 Left 1023764541 7:43498342-43498364 CCGCAGGGAGGGAGGCCAGTGGC 0: 1
1: 0
2: 6
3: 37
4: 519
Right 1023764544 7:43498366-43498388 TAACCAGATGTTGATCCCTTGGG No data
1023764532_1023764544 22 Left 1023764532 7:43498321-43498343 CCCTCTCTGGGCTTCTTTTTCCC 0: 1
1: 1
2: 28
3: 337
4: 1578
Right 1023764544 7:43498366-43498388 TAACCAGATGTTGATCCCTTGGG No data
1023764533_1023764544 21 Left 1023764533 7:43498322-43498344 CCTCTCTGGGCTTCTTTTTCCCG 0: 1
1: 0
2: 6
3: 92
4: 978
Right 1023764544 7:43498366-43498388 TAACCAGATGTTGATCCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023764544 Original CRISPR TAACCAGATGTTGATCCCTT GGG Intronic
No off target data available for this crispr