ID: 1023765191

View in Genome Browser
Species Human (GRCh38)
Location 7:43504158-43504180
Sequence GTTGAAGTCATCCAGGAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 403
Summary {0: 1, 1: 0, 2: 6, 3: 37, 4: 359}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023765191_1023765196 7 Left 1023765191 7:43504158-43504180 CCGTCCTCCTGGATGACTTCAAC 0: 1
1: 0
2: 6
3: 37
4: 359
Right 1023765196 7:43504188-43504210 GGGACCCTCATTCCGTTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023765191 Original CRISPR GTTGAAGTCATCCAGGAGGA CGG (reversed) Intronic