ID: 1023768328

View in Genome Browser
Species Human (GRCh38)
Location 7:43532420-43532442
Sequence ATCCATTGGAAGTTTCGTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 63}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023768328_1023768332 18 Left 1023768328 7:43532420-43532442 CCTACACGAAACTTCCAATGGAT 0: 1
1: 0
2: 0
3: 3
4: 63
Right 1023768332 7:43532461-43532483 GAAATCTAAAGTCCTTCCCATGG 0: 1
1: 0
2: 11
3: 82
4: 432

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023768328 Original CRISPR ATCCATTGGAAGTTTCGTGT AGG (reversed) Intronic
905090930 1:35430871-35430893 TTCCATTGGAGGATTTGTGTGGG + Intergenic
919477561 1:198048028-198048050 ATCCATTGTAAGTGTGATGTAGG + Intergenic
923114773 1:230924900-230924922 ATTCATTCGAACTTTCGAGTTGG + Exonic
923821984 1:237454978-237455000 ATCTATAGGAAGCTTCGTGTTGG + Intronic
1063631406 10:7737080-7737102 ATCCATTGGAATACTGGTGTAGG - Intronic
1065932056 10:30488728-30488750 CTCCAGTGGAAGTTTGGTGGTGG + Intergenic
1073809352 10:107135608-107135630 ATACATTGGAAGTTTCCTAATGG + Intronic
1075910682 10:126123355-126123377 ATCCAGTGGACTTTGCGTGTGGG + Intronic
1085544691 11:77306424-77306446 ATCCATTTGAAGTTGCTTGAGGG - Intergenic
1086035164 11:82405742-82405764 ATCCATTCCAAGTTTGCTGTCGG + Intergenic
1096728262 12:53583069-53583091 ATCCATTTTAAGTTTTGTGAAGG - Intronic
1097277721 12:57824501-57824523 ATCCATTGGAAGCCTGGTGAGGG - Intronic
1097772465 12:63604110-63604132 ATCCAGTGGATGTTTCCTTTAGG - Intronic
1101494406 12:105239898-105239920 ATCAAGTGGAGGTTTCATGTGGG + Intronic
1114783166 14:25562927-25562949 ATCCATTTGAAGTTAGGTGAGGG - Intergenic
1114803080 14:25800461-25800483 ATCCATTGGATTTTGCATGTTGG - Intergenic
1120641202 14:87015199-87015221 TCTCATTGGAAGTTTCGTGAAGG - Intergenic
1121033833 14:90682685-90682707 ATCCAGAGGAAGTTGCGTGAAGG + Intronic
1122017672 14:98809936-98809958 ATTCATTTGAAGTTGCCTGTGGG - Intergenic
1151082667 17:71346518-71346540 ATACTTTTGAAGTTTAGTGTGGG - Intergenic
1151232801 17:72696671-72696693 ATACATTGGAAGTTCCCTGGTGG - Intronic
1156380633 18:36557438-36557460 ATCCAGTGTAATTTTCGTCTTGG + Intronic
1157437823 18:47686263-47686285 ATCCCTTGGAAGTGTCATGGGGG + Intergenic
1164877194 19:31699780-31699802 ATCCCTTGGAAGTCTCTAGTTGG + Intergenic
926622875 2:15063022-15063044 AACCATTTGAAGTTGCTTGTGGG - Intergenic
926989335 2:18660705-18660727 ATTCATTGGAAGTTACGGGATGG - Intergenic
937713497 2:125005723-125005745 ATCCACTATAAGTTTCTTGTAGG + Intergenic
944422066 2:199542037-199542059 AACAACAGGAAGTTTCGTGTGGG - Intergenic
945861877 2:215132889-215132911 ATCCTTTGAAAATTTCTTGTAGG + Intronic
945922692 2:215771978-215772000 AACCATTGGAACTTTCCTTTTGG - Intergenic
1174672823 20:52323857-52323879 ACCCATAGGAAGACTCGTGTAGG + Intergenic
1183948118 22:41338306-41338328 ATCCATTAGAAGTTCCCTGTGGG - Exonic
1184377844 22:44125730-44125752 AGCCATTGGAGGTTTTGGGTAGG + Intronic
951372623 3:21869369-21869391 TTACATTTGAAGTTTGGTGTGGG - Intronic
951400232 3:22224452-22224474 AACCATTTGAAGTTTCTTGAAGG - Intronic
951720367 3:25691460-25691482 GTGCATTGAAAGTTTCGGGTTGG - Intergenic
955812838 3:62809247-62809269 AGCCATTGGAAGTTTCAGGCAGG - Intronic
956296794 3:67723762-67723784 ATCTATGTCAAGTTTCGTGTTGG + Intergenic
956653333 3:71525737-71525759 ATCCATAGAAAGTTTCTTTTTGG + Intronic
957449909 3:80366551-80366573 GTCCATTGGAATTTTTGTGCAGG + Intergenic
959493557 3:107021634-107021656 ATCTATTGGAATTTTACTGTAGG - Intergenic
960807515 3:121598330-121598352 ATCCACTGGAAGTTTTAAGTTGG + Intronic
963489150 3:145977030-145977052 ATCTATTGGATGTTTTCTGTTGG - Intergenic
963888293 3:150604497-150604519 ATACATTGGAATGTTGGTGTTGG + Intronic
967750794 3:193114294-193114316 ATCCATTCCAATTTTCATGTAGG - Intergenic
970073396 4:12189559-12189581 ATACAGTGGCAGTTTCATGTTGG + Intergenic
976959078 4:90944277-90944299 ATCCATTGGAAATTTATTGTTGG + Intronic
979380630 4:120002279-120002301 ATCCATTAGAGGTTTTGAGTTGG + Intergenic
989796438 5:45479757-45479779 ACCCATTGGAAATATCCTGTAGG + Intronic
993925571 5:93861370-93861392 ATCCAGGGCAAGTTTCGTGGAGG - Intronic
997175593 5:131773116-131773138 ATACATTGGAATTTTCAGGTTGG - Intronic
1007520221 6:42446213-42446235 AGCCATTGAAAGTTTGGAGTGGG - Intronic
1011325405 6:86145697-86145719 AAGCATTGGAAATTTAGTGTAGG + Intergenic
1022365767 7:29714529-29714551 ATCCAGTGGATGTTTCCTTTAGG + Intergenic
1022932028 7:35127822-35127844 ATCCAGTGGATGTTTCCTTTAGG - Intergenic
1023768328 7:43532420-43532442 ATCCATTGGAAGTTTCGTGTAGG - Intronic
1024476643 7:49819157-49819179 ATGTATTGGCAGTTTTGTGTAGG - Intronic
1039154633 8:34541009-34541031 TTCCTCTGGAAGTTTCGTCTCGG - Intergenic
1043605072 8:81990461-81990483 TTCCTCTGGAAGCTTCGTGTCGG + Intergenic
1047405501 8:124582262-124582284 AACCATTGAAAGTTTCTTGAAGG + Intronic
1047556700 8:125939672-125939694 ATCCAATGCATGTTTCTTGTAGG - Intergenic
1058541015 9:106012694-106012716 ACCCATTGGAATTCACGTGTGGG + Intergenic
1058848677 9:108988556-108988578 AGCCATTGGAGGTTTTGAGTAGG - Intronic
1059967743 9:119632634-119632656 ATCCATTGGTAGTCTCAAGTAGG + Intergenic
1190510414 X:51168802-51168824 ATGCATTGCAATTTTAGTGTTGG - Intergenic
1198733935 X:139765693-139765715 ATCAATTGGAATTTTCATATAGG + Intronic
1199770589 X:150972883-150972905 CTCCATTGCAAGTTTCTTGAGGG + Intergenic