ID: 1023770856

View in Genome Browser
Species Human (GRCh38)
Location 7:43555434-43555456
Sequence CTCTTCAGTGCTTCCTGATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 161}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023770856_1023770857 -8 Left 1023770856 7:43555434-43555456 CCTGATCAGGAAGCACTGAAGAG 0: 1
1: 0
2: 0
3: 20
4: 161
Right 1023770857 7:43555449-43555471 CTGAAGAGACAGTTGTGCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023770856 Original CRISPR CTCTTCAGTGCTTCCTGATC AGG (reversed) Intronic
902122039 1:14174392-14174414 CTCTTCAATGCTTCCTGTCCTGG - Intergenic
902952072 1:19892877-19892899 CTTTTTAGTTCTTCATGATCTGG + Intronic
904976533 1:34461087-34461109 CCCTGCAGAGCTTCCTGACCTGG + Intergenic
905541467 1:38763646-38763668 CCCTTCAGTGCTCCCTGTTTTGG + Intergenic
905784527 1:40743609-40743631 TTCCTCAGTGCCTCCTGATTGGG + Intronic
906046514 1:42835126-42835148 CTCTTCTTTGCTTCCAGATAAGG - Exonic
908273029 1:62438420-62438442 CTTTCCAGTGCTTCCTGATTTGG + Intronic
908931959 1:69327701-69327723 CTCTTCTGTGCTTTATGATGAGG - Intergenic
916184351 1:162116302-162116324 CTGTCCAGTGCTTCCAGAACGGG + Intronic
920070638 1:203300554-203300576 CTCTTCCTTGCTTCCTAATCAGG - Intergenic
921432455 1:215081325-215081347 CTATAATGTGCTTCCTGATCTGG - Intronic
924815386 1:247437120-247437142 CTCTACAGGGCTTCTTCATCTGG + Intronic
1062980167 10:1715576-1715598 CTCACCAGTGTTTCCTCATCTGG + Intronic
1064049853 10:12050474-12050496 CTGTTCCTTGCTTCCTGACCTGG - Intergenic
1064827400 10:19420560-19420582 CTCATCAGTGATTCATGCTCTGG + Intronic
1064890805 10:20170628-20170650 CTATTCAGAGCTTCCTGTGCTGG + Intronic
1069634570 10:69917485-69917507 CTCATCAGTGCCCCCTGATGCGG + Intronic
1073043034 10:100620375-100620397 CTCTTCTGAGCTTCCTGTTCTGG + Intergenic
1073252454 10:102129398-102129420 GTCTTCAGTGCCACCTGAACAGG - Intergenic
1074851481 10:117442828-117442850 CCCTTCTGTGCTTCTGGATCAGG + Intergenic
1076677394 10:132154143-132154165 CTCTCCAGAGCTGCCTGATGGGG + Intronic
1081356296 11:42118408-42118430 CTCTGCTGTGTTTCCTGAGCTGG + Intergenic
1081651473 11:44826995-44827017 CTCTTGGGTGCTTCCTGTTGTGG + Intronic
1081899740 11:46617645-46617667 CTCTTCAGTGCTTCCCTCACTGG - Exonic
1085699192 11:78731117-78731139 CTTTACAGTGCTCCCTGAGCTGG - Intronic
1087804987 11:102545668-102545690 GTGTTCAGTGCTTCCTCCTCAGG + Intergenic
1088611921 11:111585632-111585654 CTCTTCAGTGTTTAGGGATCTGG + Intergenic
1089220866 11:116870331-116870353 CTCTGCACAGCTTCCTGGTCTGG + Exonic
1091449669 12:564681-564703 CTCTTCTCTGCTTCCTCAACAGG - Exonic
1095266012 12:40158705-40158727 CTCTTCATTGCTTTCTGTACAGG + Intergenic
1100004556 12:89878823-89878845 CACTTCAGTGCTTCCTTCCCAGG - Intergenic
1100031687 12:90200293-90200315 CTCTCCAGTGCTTGGTGATAAGG + Intergenic
1100478893 12:94959258-94959280 CATTTTAGTGCTTCCAGATCTGG + Intronic
1102461048 12:113099859-113099881 CTCTTCAGCGCATCCTGCCCCGG - Exonic
1105959252 13:25314283-25314305 CTCTTCTTTGTTTCCTTATCTGG - Intronic
1112015981 13:95331867-95331889 CTCTTCTGTGCTTACTCATGTGG - Intergenic
1112602349 13:100868946-100868968 CACTACAGTGCGTCCTGCTCTGG - Intergenic
1114825592 14:26074468-26074490 CTCTACATTTCTTCCTGAACAGG + Intergenic
1115704445 14:35984475-35984497 CACTTCAGTCCTTTCTGATGTGG + Intergenic
1116379817 14:44251477-44251499 CACTTCAGTGCTTAGTGGTCTGG + Intergenic
1122445551 14:101765219-101765241 CCCTTCACTGCTTCCTCATAAGG + Intronic
1122652474 14:103232962-103232984 CGCCTCAGTGCCTTCTGATCCGG - Intergenic
1122976635 14:105173569-105173591 CTCTGGAGGGCTTCGTGATCGGG - Intronic
1125169486 15:36750032-36750054 CACTTCACTTCTTCCTGAGCAGG + Intronic
1130321654 15:82847484-82847506 CTCTTCAGTGCTTGGTGAACTGG + Intronic
1132258475 15:100400058-100400080 CACTTCAGTGGTTCCTGCACAGG + Intergenic
1133287011 16:4695173-4695195 CTCTTGAGGGCTGCCTGAGCTGG + Exonic
1134625914 16:15722579-15722601 ATCTTCAATGCTTCGTTATCTGG - Intronic
1136027984 16:27482137-27482159 CTCCCCACTGCTTCCTGCTCTGG + Intronic
1139157211 16:64457956-64457978 TTCTTCATCACTTCCTGATCAGG - Intergenic
1139717019 16:68821887-68821909 CTCTTCAGTGGTCCCTCACCAGG - Intronic
1140853347 16:78955074-78955096 CTCTGCGGAGTTTCCTGATCAGG - Intronic
1144727972 17:17511317-17511339 CAGTTCAGTGCTTCCTGCTCAGG - Intronic
1148684423 17:49493338-49493360 CTCTTCAGTGATTTCTGAAGAGG + Intergenic
1149408034 17:56375011-56375033 TTCTTCAGTGTTTCCTACTCAGG - Intronic
1150600690 17:66648332-66648354 CTATTCAGTGCTTCCTCCACAGG + Intronic
1152322724 17:79617245-79617267 CTCTTCTGTCTTTCCTGCTCTGG + Intergenic
1153724762 18:7943289-7943311 CTCTTCATGCCTTCCTGGTCTGG + Intronic
1154057453 18:11025169-11025191 CTCTGCCCTGCTTCCTCATCCGG + Intronic
1159056893 18:63475038-63475060 CTGTTCAGTGCTTGCTCAACCGG - Intergenic
1160684515 19:427342-427364 CTCTCCAGTGCATGCTGAGCCGG - Intronic
1161614022 19:5260124-5260146 CTCCACAGTTCTTTCTGATCTGG - Intronic
1161730647 19:5958697-5958719 CTCATCTGTGCTTCCTGTGCGGG - Intronic
1162867568 19:13560426-13560448 TCCTCCAGTGCTTCCTGATGGGG + Intronic
1162959828 19:14118943-14118965 CTCTTAAGTGCTTCTCAATCAGG - Intergenic
1163125500 19:15242258-15242280 CTGGTCAGTGCCTCCTGATGTGG - Intronic
1163172936 19:15545210-15545232 TTCTTCAGTGCCTTCTGCTCAGG - Intronic
1166240310 19:41486950-41486972 CTCTTCAGTGCTGTCAGATGGGG - Intergenic
925163188 2:1701172-1701194 CGCTTCAGTGCTTCCTACTAAGG + Intronic
925180065 2:1811772-1811794 CTCTTCAGTCCTCCCTGATGGGG + Intronic
925479750 2:4256791-4256813 CAGTTCTGTGCTTCCTGCTCAGG + Intergenic
926430572 2:12781079-12781101 CTGTTCAGTGCTGTCTGTTCTGG - Intergenic
927854365 2:26518716-26518738 CTCTTTAGTGACTCCTGAGCTGG + Intronic
927862689 2:26570077-26570099 CTGTTCAGGGCTTACTGCTCAGG - Intronic
929528392 2:42727545-42727567 CTCTTCAGGGCTTTCTGACATGG - Intronic
931131598 2:59342452-59342474 CTGTTCAGTGATTCCTCATCAGG - Intergenic
934625611 2:95847959-95847981 CTTTTCAGAGCTTTCTGTTCAGG + Intronic
936244369 2:110813785-110813807 GTATTGAGTCCTTCCTGATCAGG + Intronic
936508713 2:113128720-113128742 CTCTTCAGAGCCACCTGATGAGG + Intronic
936923705 2:117715255-117715277 CACTTCAGTGTTTCCTCACCTGG - Intergenic
937354558 2:121190039-121190061 ATCTTCAGTGCTTCCGGAAATGG + Intergenic
938118313 2:128617119-128617141 CTGTTCTGTGCTTCCTGCTCAGG + Intergenic
938187458 2:129244240-129244262 TTCTTCAGTGGTTCTTGGTCTGG + Intergenic
940162910 2:150733030-150733052 CATGTCAGTGCTTCCTGATAAGG - Intergenic
944690624 2:202155491-202155513 CTCCTCAGAGCTTACTGAACTGG + Intronic
944709719 2:202324801-202324823 CTCTTCAGTGCATCATGAGGAGG - Intergenic
944956134 2:204811569-204811591 CACTCCAATGCTTCCTCATCAGG - Intronic
946386361 2:219386764-219386786 CTCCTCAGTACTTCATGACCAGG - Exonic
947302127 2:228700026-228700048 CTTTTCAGTGATTCCAGATGAGG + Intergenic
948685622 2:239667953-239667975 ATCTTCAGTGCTTGCTGTTCCGG - Intergenic
1173288725 20:41695622-41695644 CTCCTATGTGCTTGCTGATCAGG + Intergenic
1175610771 20:60349362-60349384 CTCTGCAGGCCTTCCTGTTCTGG + Intergenic
1175821243 20:61910068-61910090 GTCTTCTCTGATTCCTGATCTGG + Intronic
1176455893 21:6910142-6910164 CTCTTCAGTGCACTCTGTTCAGG - Intergenic
1176834067 21:13775190-13775212 CTCTTCAGTGCACTCTGTTCAGG - Intergenic
1177015441 21:15781949-15781971 ATCTGGAGTGCTTCCTGACCTGG + Intronic
1177569740 21:22871524-22871546 CTCTTCAGTGCCTCTTGAAGCGG + Intergenic
1178959788 21:37054861-37054883 CTCTTCAGCTCATCCTTATCAGG - Intergenic
1179583824 21:42362164-42362186 ATCTTCTGGGCTTCCTGAGCTGG - Intergenic
949682348 3:6528734-6528756 TTCTACAGTCCTTCCTGATCTGG + Intergenic
951833752 3:26959223-26959245 CTCTTCAGAGCTGCCAGATGGGG + Intergenic
953079563 3:39603224-39603246 CTATTCATTGCTTCCAGCTCTGG + Intergenic
953208385 3:40852315-40852337 CTCTACAGCGGTTCCTGCTCAGG - Intergenic
953362098 3:42306604-42306626 TTCTTGAGTGCCTCCTCATCTGG + Intergenic
953856879 3:46506121-46506143 CTCTGCAGTGCTGCCTGTCCCGG - Intergenic
956171436 3:66436651-66436673 CTCTTCAGTTCTTCCTGTGCAGG - Intronic
957436768 3:80187544-80187566 CTCTTCACTGCTTCCTAAATGGG + Intergenic
958600864 3:96295006-96295028 CTCTTCAGTGCTGCCTACGCTGG + Intergenic
959345574 3:105190884-105190906 CTCTTCAGGGCTTGCTTATCAGG + Intergenic
961238233 3:125387139-125387161 CTCTTCAGACCTTCATCATCTGG - Intergenic
961321188 3:126077801-126077823 CTCCTCCGTGCTTCCTTCTCAGG + Intronic
964507657 3:157417250-157417272 GTCTTCAGTGCTTCCTCATTGGG + Intronic
966600122 3:181766620-181766642 CTCTTCATTTCTTCCTTATTTGG + Intergenic
967314354 3:188137314-188137336 TCCTTCAGTACTTCCTGATGAGG + Intergenic
970028571 4:11650886-11650908 CTGTTCAGTGATGCCTGAACCGG - Intergenic
972233907 4:37107016-37107038 CTCTTCAAGGCTTCCTGCTTAGG + Intergenic
972967962 4:44535696-44535718 CTCTTCACGGCTTCCAGCTCAGG + Intergenic
977836895 4:101655896-101655918 CTCTTCACTGCTTCCTGAGATGG + Intronic
980743349 4:136980887-136980909 CTCTTCAGTGCATTCCAATCAGG - Intergenic
980899163 4:138887978-138888000 CTCTTCAGTGTTTTCTTATATGG - Intergenic
981073233 4:140567236-140567258 CTCTTAAGAGGTTCCTCATCAGG - Intronic
981405121 4:144358951-144358973 CTCTTCAGTGCTCTCTGCCCAGG + Intergenic
986280064 5:6315575-6315597 CTCTTAATTGCTTCCTCTTCTGG + Intergenic
991166361 5:63568403-63568425 CACTTGAGGGCTTTCTGATCTGG + Intergenic
994524432 5:100884737-100884759 TTCCTTATTGCTTCCTGATCTGG - Intronic
998881774 5:146652516-146652538 CTCTTCAGTTCTCCCTGAGCAGG - Intronic
999038853 5:148384460-148384482 GTGTTCACTGCTTCCTGCTCAGG - Intronic
1001192006 5:169640018-169640040 CTCTTCATTGCTTTCTGTGCAGG + Intronic
1007051665 6:38837164-38837186 ATCTTCATGCCTTCCTGATCTGG + Intronic
1010700596 6:79040352-79040374 CTCTTGAGTCCTTTCTGAACAGG - Intronic
1011627099 6:89291529-89291551 CACTTCGCTGCTTCCTGCTCCGG + Intronic
1015541462 6:134318085-134318107 CTCTTCAGTGTGCCCTGAGCCGG - Intronic
1016688699 6:146910914-146910936 CTATGCAGTGTTTCCTGATTAGG + Intergenic
1017430370 6:154364814-154364836 CTCGTCTGTGCTTCAAGATCAGG - Intronic
1019642738 7:2113171-2113193 CTCTTCCGTGTTTCCTGAGTGGG - Intronic
1020812174 7:12861841-12861863 CTTTTCAGTGGTTCTTAATCTGG + Intergenic
1022869176 7:34457808-34457830 CTCTTCAGAGCTGCCTGGTAGGG - Intergenic
1023145348 7:37145552-37145574 CTCTTGAATGCTTCCTGGTTGGG + Intronic
1023449132 7:40263413-40263435 TTCCTCAGGGCTTCATGATCAGG - Intronic
1023542736 7:41283403-41283425 CCCCTCCCTGCTTCCTGATCCGG - Intergenic
1023770856 7:43555434-43555456 CTCTTCAGTGCTTCCTGATCAGG - Intronic
1026265324 7:68791310-68791332 CTCTTCAGAGCTACCAGAGCTGG - Intergenic
1026945760 7:74314962-74314984 CTCTTCTGTGCTTCATCATAAGG + Intronic
1029483158 7:100824837-100824859 ACCTCCAGTGCTTCCTGATCAGG - Intronic
1030348919 7:108461640-108461662 CTTTCCATTGCTTACTGATCAGG - Intergenic
1034641336 7:152606151-152606173 CTCTGCATTGCTTCCTAGTCAGG + Intergenic
1035929995 8:3770034-3770056 CTTTGCTGTGATTCCTGATCAGG + Intronic
1036405734 8:8453718-8453740 CTCACCAGTGCTTCCTCAGCTGG - Intergenic
1036470044 8:9044924-9044946 CTCTTAAGGGCTTCGTGGTCAGG - Intronic
1037598523 8:20374254-20374276 CTCTTCACTGTTTCCTGATGTGG - Intergenic
1037717258 8:21411011-21411033 CTCTTCTGTGCACCCAGATCTGG + Intergenic
1038310036 8:26439388-26439410 CTCTTCCTGGCTTTCTGATCTGG + Intronic
1040905644 8:52467365-52467387 GTGGTCAGTGCTTCCTGTTCAGG - Intergenic
1041885962 8:62808381-62808403 TTCTTCAGTGCATCATCATCTGG + Intronic
1041892041 8:62879974-62879996 CTCTTCATTGCTTCCTAATAAGG - Intronic
1042253351 8:66778195-66778217 TTCTTCAGTGCTTCATGTCCTGG + Intronic
1042273972 8:66984307-66984329 TTCTTCACAGCTTCCTCATCAGG + Intronic
1043298576 8:78698110-78698132 CTCTTCATAGCTTTCTGAACTGG + Intronic
1047507981 8:125495008-125495030 CTCTTCAAGGCTTCCTGGTCTGG + Intergenic
1047648570 8:126895387-126895409 CTCTAAAGTGCTGCCTGTTCTGG - Intergenic
1047915296 8:129576755-129576777 ATCTTCACTGCTTGCTTATCTGG - Intergenic
1049776230 8:144406664-144406686 CTCTGCACTGCTGCCTGATGTGG + Intronic
1049776242 8:144406745-144406767 CTCTGCACTGCTACCTGATGTGG + Intronic
1052859188 9:33426492-33426514 CTCCTCTGGGCTTCCTGACCTGG - Intergenic
1052873374 9:33530569-33530591 CTATTCTGTGCTTCTTAATCAGG - Intronic
1052987931 9:34501746-34501768 CTCCTCAGGCCTTCCTGACCGGG + Intronic
1053372920 9:37577428-37577450 CTATTAAGTGCTGCGTGATCTGG - Intronic
1053502726 9:38614177-38614199 CTATTCTGTGCTTCTTAATCAGG + Intergenic
1055733362 9:79302347-79302369 CCCTTCAGTGCTTTCTGTCCTGG - Intergenic
1057153363 9:92815451-92815473 CTATTCTGTGCTTCTTAATCAGG - Intergenic
1057357374 9:94342898-94342920 TTCTTAAGTGCTTCCTCCTCTGG - Intergenic
1057650378 9:96914728-96914750 TTCTTAAGTGCTTCCTCCTCTGG + Intronic
1057682553 9:97203455-97203477 CTATTCTGTGCTTCTTAATCAGG + Intergenic
1060992246 9:127855889-127855911 CCCATCAGTGCTCCCTGAGCTGG + Intergenic
1062112827 9:134791380-134791402 CTCTTCAGAGCCTCCCGTTCAGG + Intronic
1062643030 9:137531416-137531438 GTTTTCACAGCTTCCTGATCTGG - Intronic
1186624163 X:11274497-11274519 CTTTTCAGTGGGTCCAGATCTGG - Intronic
1189230957 X:39451838-39451860 CTCTTCAGTGCTTACACATGAGG + Intergenic
1195314735 X:103666378-103666400 CTGTTCCGTGCTTTCTGCTCTGG - Intergenic
1196023050 X:111010409-111010431 CTCTTAAGTGCTAGCTGATATGG + Intronic
1196090046 X:111731035-111731057 CTCTTCAGTGGGACCTGCTCTGG - Intronic
1198880587 X:141276883-141276905 CTTTGCAGGGCTTCCAGATCAGG - Intergenic