ID: 1023774863

View in Genome Browser
Species Human (GRCh38)
Location 7:43595561-43595583
Sequence GCACCATGCCTGGCTTCAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 472
Summary {0: 1, 1: 0, 2: 6, 3: 75, 4: 390}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023774855_1023774863 18 Left 1023774855 7:43595520-43595542 CCACCTGCCTCAGCCTCCCAAAA 0: 1612
1: 31176
2: 92073
3: 173327
4: 187080
Right 1023774863 7:43595561-43595583 GCACCATGCCTGGCTTCAACTGG 0: 1
1: 0
2: 6
3: 75
4: 390
1023774854_1023774863 29 Left 1023774854 7:43595509-43595531 CCTCAAGTGAGCCACCTGCCTCA 0: 17
1: 3115
2: 16761
3: 43978
4: 76685
Right 1023774863 7:43595561-43595583 GCACCATGCCTGGCTTCAACTGG 0: 1
1: 0
2: 6
3: 75
4: 390
1023774858_1023774863 5 Left 1023774858 7:43595533-43595555 CCTCCCAAAATGCTGAGATTACA 0: 1101
1: 32557
2: 331431
3: 263840
4: 198379
Right 1023774863 7:43595561-43595583 GCACCATGCCTGGCTTCAACTGG 0: 1
1: 0
2: 6
3: 75
4: 390
1023774859_1023774863 2 Left 1023774859 7:43595536-43595558 CCCAAAATGCTGAGATTACAAAG 0: 2
1: 24
2: 515
3: 7756
4: 74797
Right 1023774863 7:43595561-43595583 GCACCATGCCTGGCTTCAACTGG 0: 1
1: 0
2: 6
3: 75
4: 390
1023774860_1023774863 1 Left 1023774860 7:43595537-43595559 CCAAAATGCTGAGATTACAAAGG 0: 1
1: 12
2: 275
3: 4920
4: 50240
Right 1023774863 7:43595561-43595583 GCACCATGCCTGGCTTCAACTGG 0: 1
1: 0
2: 6
3: 75
4: 390
1023774857_1023774863 11 Left 1023774857 7:43595527-43595549 CCTCAGCCTCCCAAAATGCTGAG 0: 401
1: 10972
2: 111187
3: 241043
4: 351511
Right 1023774863 7:43595561-43595583 GCACCATGCCTGGCTTCAACTGG 0: 1
1: 0
2: 6
3: 75
4: 390
1023774856_1023774863 15 Left 1023774856 7:43595523-43595545 CCTGCCTCAGCCTCCCAAAATGC 0: 2950
1: 69895
2: 192442
3: 319640
4: 368867
Right 1023774863 7:43595561-43595583 GCACCATGCCTGGCTTCAACTGG 0: 1
1: 0
2: 6
3: 75
4: 390

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023774863 Original CRISPR GCACCATGCCTGGCTTCAAC TGG Intronic
901009221 1:6189630-6189652 GCACCCTGCCTGGCCTGTACAGG - Intronic
902894124 1:19467161-19467183 CCACCATGCCTGGCAACTACGGG + Intronic
903040142 1:20523318-20523340 CCACCATGCCTGGCCTCAGCTGG + Intergenic
903270763 1:22186827-22186849 CCACCATGCCTGGCCTCACCTGG + Intergenic
903599831 1:24529263-24529285 CCACCATGCCTGGCCACACCTGG - Intronic
904559126 1:31385164-31385186 ACACCCTTCCTGGCTTCCACCGG - Intergenic
904639129 1:31909386-31909408 CCACCACGCCTGGCCTCACCTGG - Intronic
904732599 1:32606241-32606263 GCTCCATGCCAGGCTGCAGCGGG + Intronic
905089428 1:35416849-35416871 CCACCATGCCTGGCCTCAGTTGG + Intronic
905858774 1:41332310-41332332 CCACCATGCCTGGCCTTGACTGG - Intergenic
906023077 1:42648225-42648247 CCACCATGCCTGGCCTTAAGAGG + Intronic
906497121 1:46312536-46312558 ATACCATGCCTGGCCTCAAGGGG + Intronic
906801018 1:48736994-48737016 CCACCATGCCTGGCTGTCACTGG - Intronic
907303169 1:53500713-53500735 GCCCCAGGCCTGGGTGCAACAGG - Intergenic
907373799 1:54019496-54019518 CCACCATGCCTGGCCTCCTCTGG - Intergenic
908100454 1:60785870-60785892 CCACCATGCCCGGCTGCACCTGG - Intergenic
908391748 1:63689405-63689427 GCACAGTGCCTGGCCACAACAGG + Intergenic
908581328 1:65520281-65520303 CCACCATGCCTGGACTTAACCGG + Intronic
908761736 1:67519144-67519166 CCACCATGCCCGGCTTCCAAGGG - Intergenic
910401040 1:86838475-86838497 CCACCATGCTTGGCTTCTACTGG - Intergenic
910659485 1:89655944-89655966 ACACCATACCTGCCTTCAAGGGG + Intronic
911766455 1:101681423-101681445 GCACCCTGCCTGACTGCCACTGG + Intergenic
911795463 1:102070480-102070502 GGACAATGACTGGCATCAACTGG - Intergenic
917078368 1:171229906-171229928 CCACCATGCCTGGTCTCATCAGG - Intergenic
917422868 1:174883109-174883131 CCACCACGCCTGGCCTCTACTGG + Intronic
918450545 1:184653596-184653618 CCACCATGACTGGCTGCAATTGG - Intergenic
918744255 1:188180027-188180049 GTAATATGCTTGGCTTCAACAGG - Intergenic
918952684 1:191160291-191160313 CCACCATGCCCGGCTGCACCTGG - Intergenic
919069562 1:192736556-192736578 CCACCATGCCTGGCTGAGACTGG + Intergenic
919773478 1:201178027-201178049 CCACCATCCCTGTCTTCAGCAGG - Intergenic
919876810 1:201875300-201875322 CCACCATGCCTGGCTATAAATGG - Intronic
920005686 1:202832225-202832247 CCACCATGCCTGGCTGCTACTGG - Intergenic
920014198 1:202892887-202892909 TCACCATGCCTGGCCTCCAGTGG - Intronic
920111803 1:203592296-203592318 CCACCAGGCCTAGCTTCCACAGG + Intergenic
920537462 1:206747907-206747929 CCACCATGCCTGGCCTAAACTGG + Intergenic
921276304 1:213524213-213524235 GCAGCATGCCTGGGTTCTGCTGG - Intergenic
921555667 1:216596070-216596092 GCCCCATCCCTGGGGTCAACTGG + Intronic
921633717 1:217466510-217466532 CCACCATGCCTGGCTAAAAATGG + Intronic
922161292 1:223080673-223080695 GCTCCATGCCTGGCTCACACAGG + Intergenic
922954896 1:229590924-229590946 CCACCATGCGTGGCCTCAGCTGG + Intergenic
1064790142 10:18949830-18949852 CCACCATGCCTGGCCAAAACAGG + Intergenic
1065216134 10:23450628-23450650 CCACTATGCCTGGCTACATCTGG + Intergenic
1065635670 10:27730743-27730765 TCACCATGCCCGGCCTCAATTGG + Intronic
1065961411 10:30737084-30737106 GCTCCATGCCTGTTTTCAACTGG - Intergenic
1066407283 10:35129907-35129929 CCACCATGCCCGGCCTAAACTGG - Intronic
1066477722 10:35764241-35764263 GCACCGTGCCTGGCTCCAGTTGG - Intergenic
1067096936 10:43307606-43307628 CCACCATGCCTGGCCAAAACTGG - Intergenic
1067098386 10:43317179-43317201 GCACCTGGCCTGGCTTCCAGAGG + Intergenic
1067129377 10:43547705-43547727 CCACCACGCCTGGCTCCAAAGGG + Intergenic
1067567282 10:47348547-47348569 GCACCAGGCTTGGCTGGAACAGG - Exonic
1069531615 10:69223868-69223890 CCACCATGCCTGGCCTCATTTGG + Intronic
1069547879 10:69341741-69341763 CCACCATGCCTGGCCTCTTCTGG + Intronic
1069696835 10:70392702-70392724 CCACCATGCCTGGCCACATCTGG - Intergenic
1070629869 10:78076827-78076849 CCACCATGCCTGGCCTGCACAGG + Intergenic
1071943567 10:90615208-90615230 CCACCATGCCTGGCACCAGCTGG - Intergenic
1072283658 10:93893560-93893582 GCACCATGCTTGTCTTTAAATGG - Intergenic
1072542662 10:96410227-96410249 GCACCATGCCTGGCATACAGTGG + Intronic
1073470026 10:103716519-103716541 GGATCATGGCTGGCTTCAGCAGG + Intronic
1073767195 10:106695648-106695670 ACACCATGCCTGGCATAAAGTGG + Intronic
1074693429 10:116027174-116027196 GCATCATGCCTGGCATCAGTAGG - Intergenic
1074785133 10:116832451-116832473 CCACCGTGCCTGGCTGCAAAGGG + Intergenic
1075113116 10:119603980-119604002 CCACCATGCCTGGCCTAGACTGG + Intergenic
1075786124 10:125051350-125051372 CCACCATGCCTGGCCTGAAAAGG - Intronic
1075838547 10:125477264-125477286 GCACCCTGCCTGGCTCCAGCAGG + Intergenic
1076019118 10:127055965-127055987 GGACCATGCCTGGCTCCTGCTGG - Intronic
1076132664 10:128024714-128024736 GCTCCCTGCCTGGCTTGGACTGG - Intronic
1076245242 10:128942280-128942302 ACACCATGCCTGGCTCCCAGGGG - Intergenic
1076815722 10:132913862-132913884 GCACCAGGCCAGGCTTCAGGTGG - Intronic
1077326715 11:1967129-1967151 GCACCCTGCCTGGCTTCAGGAGG + Intronic
1078255510 11:9655315-9655337 ACACCATGCCTGGCCTAAGCAGG + Intergenic
1078457150 11:11484303-11484325 CCACCATGCCTGGCCTCACCTGG - Intronic
1080248346 11:30204644-30204666 GAACCATGGCAGGCTTCAAGAGG - Intergenic
1080861017 11:36150238-36150260 CCACTGTGCCTGCCTTCAACAGG - Intronic
1081952198 11:47054020-47054042 TCACCGTGCCCGGCTGCAACAGG - Intronic
1082086530 11:48054895-48054917 CCACCATGCCTGGCTGCCAGCGG - Intronic
1084435082 11:69134807-69134829 CCACCACGCCTGGCCTCACCAGG + Intergenic
1084569383 11:69950346-69950368 GCCCCATGCTTGGCTCCAAAGGG + Intergenic
1085125458 11:73999080-73999102 TCACCATGCCTGGCTAAAAAGGG + Intergenic
1085186454 11:74579943-74579965 GCACCCTGCTTGGCTAAAACTGG - Intronic
1085301023 11:75458384-75458406 CCACCACACCTGGCTTCAAAAGG - Intronic
1085575485 11:77599166-77599188 CCACCATGCCTGGCCACACCTGG + Intronic
1086293372 11:85336565-85336587 CCACCATGACTGGCATCAGCAGG + Intronic
1087803063 11:102525165-102525187 CCACCATGCCTGGCCTGGACTGG - Intronic
1088663443 11:112071803-112071825 CCACCATGCCTGGCCTTAAATGG - Intronic
1089061930 11:115632886-115632908 TCACCATGCCCGGCCTCAATTGG + Intergenic
1089342138 11:117765205-117765227 GCTCTGTGCCTGGCTCCAACCGG + Intronic
1089785433 11:120903851-120903873 CCACCACGCCTGCCTTCAAAAGG + Intronic
1090092223 11:123708944-123708966 CCACCGTGCCTGGCTTGATCAGG + Intergenic
1202809696 11_KI270721v1_random:22309-22331 GCACCCTGCCTGGCTTCAGGAGG + Intergenic
1091745623 12:2990910-2990932 CCACCATGCCTGGTCACAACTGG - Intronic
1092792649 12:12083249-12083271 CCACCGTGCCTGGCCTCACCTGG + Intronic
1093910446 12:24741416-24741438 GCACCATGGCTCGGTTCAACTGG + Intergenic
1095309389 12:40679859-40679881 ACACCACGCCCGGCCTCAACAGG - Intergenic
1096387446 12:51204220-51204242 GCAGCTTGACTGGCTTCAGCAGG + Exonic
1096418555 12:51435468-51435490 CCACCACGCCTGGCTTCACAAGG - Intronic
1096809481 12:54160442-54160464 GCACCATGCCTGCCTATAGCAGG - Intergenic
1097034247 12:56112239-56112261 CCACCATGCCTGGCTCAAAATGG + Intronic
1097556140 12:61139838-61139860 CCACCATGCCTGGCTTTACTTGG + Intergenic
1097785764 12:63757204-63757226 CCACCAGGCCTGGTTTAAACTGG - Intergenic
1098344382 12:69485753-69485775 CCACCATGCCTGACCTAAACAGG + Intronic
1099940464 12:89181752-89181774 AAACCATGCCTGTCTTCAACAGG - Intergenic
1100499578 12:95160893-95160915 CCACCATGCCTGGCCACAAGTGG - Intronic
1100563604 12:95773289-95773311 CCACCATGCCTGGCCTCCAATGG + Intronic
1100612468 12:96202812-96202834 CCACCATGCCTGGCCACCACAGG + Intronic
1102087269 12:110152876-110152898 CCACCATGCCTGGCTTATTCGGG + Intronic
1102091407 12:110191881-110191903 CCACCGTGCCTGGCCTGAACAGG - Intronic
1102802800 12:115751261-115751283 CCACCATGCCTGGCCTAAGCAGG + Intergenic
1102914931 12:116745546-116745568 CCACCATGCCTGGCCTCACTAGG + Intronic
1104949787 12:132434227-132434249 GCACCATGCCTGGGGTCACCAGG + Intergenic
1105342443 13:19539855-19539877 CCACCATGCCTGGCCCCAATGGG - Intergenic
1107635915 13:42392458-42392480 GCACCATGCCTGGCTTCAGGTGG + Intergenic
1107794121 13:44032275-44032297 CCACCATGCCTGGCCTCATTAGG + Intergenic
1109177343 13:59172973-59172995 CCACCATGCCTGGCATCACCTGG - Intergenic
1109687893 13:65844540-65844562 GCACCATGCGAGGCTGCAGCTGG - Intergenic
1111177094 13:84608893-84608915 CCACCATGCCTGGCCTCATGGGG + Intergenic
1111200324 13:84927791-84927813 CCAGCTTCCCTGGCTTCAACAGG - Intergenic
1111583257 13:90252009-90252031 CCACCATGCCTGGCCTCAATAGG + Intergenic
1112388187 13:98959584-98959606 GCACAATGCCTCCCTTCTACAGG + Intronic
1113136683 13:107098163-107098185 TCACCATGCCAGGCTTCACTGGG + Intergenic
1113254102 13:108487789-108487811 GCACCATGCCTGGCCTCCTTCGG - Intergenic
1113638693 13:111941636-111941658 TCACTCTGCCTGGCTTCAGCTGG + Intergenic
1113676261 13:112209783-112209805 GCACCCTGCCTGCCTTCCACAGG - Intergenic
1114321690 14:21551959-21551981 CCACCATGCCTGGCCCCAAGGGG - Intergenic
1114632565 14:24168788-24168810 CCACCATGCCTGGCCTCACCTGG - Intergenic
1115612603 14:35063283-35063305 CCACCATGCCTGGCCCCAAAGGG - Intronic
1116897028 14:50326497-50326519 GAAGCATGCATTGCTTCAACAGG + Exonic
1117375359 14:55113946-55113968 CCACCATGCCTGGCTAAAGCTGG + Intergenic
1118264476 14:64281283-64281305 GAACCATGCCTGGCAACATCAGG - Intronic
1118324670 14:64772945-64772967 GCCCCATGCCTAGCTTCTGCGGG - Exonic
1119352571 14:73978314-73978336 CCACCATGCCCGGCTGCCACTGG - Intronic
1119371342 14:74146969-74146991 CCACCATGCCTGGCCTCATGTGG - Intronic
1123917163 15:25043058-25043080 CCACCATGCCTGGCATCATTAGG + Intergenic
1124595380 15:31087539-31087561 CCACCATGCCCGGCCTCAATAGG + Intronic
1124956811 15:34365608-34365630 GCCCTTTGCCTGGCTTCAAGTGG - Exonic
1125727841 15:41877127-41877149 CCACCAGGCCTGGCTGCACCTGG - Exonic
1126072581 15:44877907-44877929 CCACCATGCCTGGCCTCAAGAGG + Intergenic
1126527837 15:49677440-49677462 CCACCATGCCTGGCTTGAACTGG + Intergenic
1126779155 15:52123828-52123850 CCACCATGCCCAGCTTAAACAGG + Intronic
1127571700 15:60250007-60250029 CCACCATGCCTGGCCCCAAATGG + Intergenic
1127716149 15:61651125-61651147 GCACAGTGCCTGGCACCAACAGG + Intergenic
1127863077 15:63010604-63010626 CCACAATGGCTGACTTCAACGGG + Intergenic
1127940421 15:63689874-63689896 CCACCGTGCCTGGCTTCTAATGG - Intronic
1128630455 15:69260545-69260567 CCACCGTGCCTGGCCACAACTGG + Intronic
1128815583 15:70605802-70605824 GCATCACACCTGGCTTCAGCTGG - Intergenic
1129436789 15:75547951-75547973 CCACCATGCCTGGCCCCTACTGG + Intronic
1129788742 15:78326605-78326627 CCACCATGCCTGGCCTGAATTGG - Intergenic
1130367273 15:83251923-83251945 TGACCATGCCTGGCCTCAGCAGG - Intergenic
1131253262 15:90844846-90844868 CCACCACGCCTGGCTAAAACTGG + Intergenic
1132195271 15:99909828-99909850 GGACCATGTCTGCCCTCAACTGG + Intergenic
1132753466 16:1470282-1470304 CCACCATGCCTGGCTCAAAATGG + Intronic
1133189703 16:4124533-4124555 CCACCATGCCTGGCTTCTCCTGG - Intergenic
1133228757 16:4356238-4356260 CCACCATGCCTGGCCACACCTGG + Intronic
1134174023 16:11991452-11991474 AAACCATGCCTTGCTTCCACGGG - Intronic
1134239564 16:12495433-12495455 CCACCATGCCTGGCGTCATCTGG + Intronic
1134253098 16:12588540-12588562 CCACCATGCCTGGCTGGATCTGG - Intergenic
1134651491 16:15912434-15912456 CCACCATGCCTGGCCCCAAAGGG - Intergenic
1135152594 16:20021960-20021982 GGTCCATGCCTGGCTTCCAAAGG + Intergenic
1135667878 16:24351281-24351303 CCACCATGCCTGGCTGAAACTGG - Intronic
1138754420 16:59465895-59465917 CCACCATGCCTGGCCACAACAGG + Intergenic
1139808063 16:69586688-69586710 CCACCATGCCCGGCCTCGACTGG + Intronic
1139849037 16:69939761-69939783 CCACCATGCCTGCCTGCAGCAGG - Intronic
1140757212 16:78078505-78078527 GCACCATGCCTGGCTAATCCAGG - Intergenic
1141520787 16:84577530-84577552 CCACCATGCCTGGCCGGAACAGG + Intronic
1141712320 16:85707197-85707219 CCACCATGCCTGGCCACAAATGG - Intronic
1142692296 17:1613954-1613976 CCACCGCGCCTGGCTTCACCTGG - Intronic
1143094363 17:4469372-4469394 CCACTGTGCCTGGCCTCAACTGG + Intronic
1144443561 17:15305631-15305653 CCACCCTCCCTGGCTTCAACAGG + Intronic
1144747891 17:17627790-17627812 CCACCATGCCTGGCCTCACCTGG + Intergenic
1146074219 17:29713046-29713068 CCACCATGCCCAGCCTCAACTGG - Intronic
1146100802 17:29979819-29979841 GCACAATGCCTGGCATGAGCTGG + Intronic
1146314963 17:31799655-31799677 CCACCATGCCTGGCTTGTGCAGG - Intergenic
1147324477 17:39663711-39663733 GCCCCCTGCCAGGCTTCAGCGGG + Intergenic
1147497200 17:40928041-40928063 GCACAATGCCTGGCACCATCGGG + Intronic
1147937080 17:44018176-44018198 CCACCATGCCTGGCTTCTCATGG - Intronic
1147983444 17:44289557-44289579 ACACCATGCCTGGCTAAGACAGG + Intergenic
1148271521 17:46265763-46265785 CCACCATGCCCGGCCTCAACAGG + Intergenic
1149373376 17:56019205-56019227 ACACCATGCCCGGCCTCCACTGG - Intergenic
1149899194 17:60458144-60458166 CCACCATGCCTGGCTGGAAAAGG - Intronic
1150765257 17:67997030-67997052 CCACCCTGCCTGGCCTCAACAGG - Intergenic
1151903181 17:77031022-77031044 CCACCATGCCTGGCTTCAGAAGG - Intergenic
1151982298 17:77520596-77520618 TCACCATGCCTGGCCTCAAAAGG + Intergenic
1152696765 17:81801498-81801520 TCACCCTGCCTGCCTTCAGCAGG - Intergenic
1152901279 17:82942456-82942478 GCTCCAGGACTGGCTTCAGCAGG - Exonic
1154025490 18:10703977-10703999 GCACAATGCCTGGCGCCACCGGG - Intronic
1155035809 18:22023953-22023975 ACACCCTGCCAGGCTACAACAGG + Intergenic
1155083453 18:22432450-22432472 CCACCATGCCTGGCCCCAAATGG + Intergenic
1155190294 18:23423475-23423497 GCAGCATCCCTGGCTTCTACTGG - Intronic
1155202204 18:23527094-23527116 CCACCATGCCTGGCCTCAGTAGG - Intronic
1155375026 18:25147915-25147937 ACACCATGCCTGGCTCTACCTGG + Intronic
1156485514 18:37463285-37463307 GCACCAGGCCTGGCTGCAGCAGG + Intronic
1157902519 18:51533404-51533426 CCACCATGCCTGGCCTTAAAGGG - Intergenic
1158927658 18:62285466-62285488 GCACCATGCCTGACTTAGACAGG - Intronic
1159002191 18:62984211-62984233 GTACCATACCTGGCTTAAAAAGG - Intergenic
1160212095 18:76889422-76889444 GCACCATGCCAGGCATCAAAAGG - Intronic
1160963249 19:1734109-1734131 GCTCCAGGCCTGGCATCAGCGGG + Intergenic
1162065926 19:8125501-8125523 CCACCACGCCTGGCCTGAACAGG - Intronic
1162067576 19:8135708-8135730 GCACCAAGACTGGCTCCAAAAGG + Intronic
1162244122 19:9384562-9384584 CCACCATGCCTGGCCGGAACTGG + Intergenic
1162997191 19:14343613-14343635 CCACCATGCCTGGCCTCAGATGG - Intergenic
1163333302 19:16655391-16655413 CCACCATGCCTGGCCTAATCTGG - Intronic
1163345139 19:16736380-16736402 CCACCATGCTTGGCTTTGACTGG + Intronic
1163456131 19:17406652-17406674 CCACCATGCCTGGCTCTAAGTGG - Intronic
1163523102 19:17803696-17803718 TCACCATGCCTGGTGCCAACAGG - Intronic
1163744569 19:19037636-19037658 CCACCATGCCTGGCCTGAAGTGG + Intronic
1163849408 19:19654863-19654885 GCACAATGCCTGGCTTCTGGGGG - Intronic
1164526696 19:29018264-29018286 CCATCATGCCTGGCTGCAAAGGG + Intergenic
1164703705 19:30304081-30304103 GCACCAGGCCTGAGTCCAACCGG - Intronic
1164783934 19:30914446-30914468 GCACCCTGGCAGGCTTCAACTGG - Intergenic
1164924054 19:32112809-32112831 CCACCATGCCTGGCTAACACTGG + Intergenic
1165029769 19:32989393-32989415 GCACCGTGCCTGGCCTCACGTGG + Intronic
1165748190 19:38243398-38243420 GCATCATGCCCGGCTTGAAGTGG - Intergenic
1166372278 19:42308834-42308856 CCACCATGCCTGGCCTCATCTGG + Exonic
1166961233 19:46497058-46497080 CCACCATGCCTGGCCTCAAAGGG + Intronic
1166971327 19:46570290-46570312 CCACCATGCCTGGCCACAATGGG + Intronic
1167061922 19:47154369-47154391 CCACCATGCCTGGCTTCTTTGGG + Intronic
1167066122 19:47187337-47187359 GCACCATGTCTGTCCTCAACAGG - Intronic
1168667296 19:58214004-58214026 CCACCATGCCTAGCTTCATTTGG + Intergenic
925003149 2:422188-422210 GCACCCTGCCTGGATTCCCCAGG + Intergenic
926085558 2:10017834-10017856 CCACCATGCCCGGCTTCAACAGG - Intergenic
926167458 2:10530486-10530508 CCACCATGCCCAGCCTCAACTGG + Intergenic
926319952 2:11742798-11742820 GCCCCATGCCTGTCTCCCACTGG - Intronic
927771381 2:25865141-25865163 CCACCATGCCTGGCCTAAATTGG - Intronic
927811039 2:26180240-26180262 GCACCATGGGTGTCTTCATCTGG + Intronic
927852389 2:26508124-26508146 GCCCCATGACTGGCTTCAACTGG + Intronic
928087288 2:28353650-28353672 CCACCACGCCTGGCCTGAACTGG + Intergenic
928099495 2:28427741-28427763 CCACCATGCCTGGCCTAAAATGG + Intergenic
928230756 2:29496981-29497003 CCACCATGCCTGGCCTCATCAGG - Intronic
928340496 2:30439317-30439339 CCACCATGCCTGGCTGAGACTGG + Intergenic
930127737 2:47815923-47815945 GGGCCATGCATGGCTTCAAAAGG - Intronic
930377565 2:50587195-50587217 CCACCATGCCTGGCCAAAACAGG - Intronic
930377809 2:50589639-50589661 CCACCATGCCTGGCCAAAACAGG + Intronic
930672138 2:54162676-54162698 CCACCATGCCTGGCCTGTACAGG - Intronic
930677933 2:54224415-54224437 GCCCCATGCCTGGCTGCACAGGG - Intronic
930742917 2:54851119-54851141 CCACCATGCCTGGCCTCATTGGG - Intronic
931338300 2:61372556-61372578 CCACCATGCCTGGCGGAAACAGG - Intronic
932263995 2:70351113-70351135 CCACCGTGCCTGGCTCCTACTGG + Intergenic
932282121 2:70502490-70502512 TCACCATGCCTGGCTAAGACGGG + Intronic
932878854 2:75480743-75480765 CCACCGTGCCTGGCCTCTACTGG + Intronic
933722528 2:85407423-85407445 CCACCATGCCTGGCTGGCACTGG - Intronic
934684969 2:96314340-96314362 CCACCATGCCTGGCCTGAATGGG + Intergenic
934723666 2:96601113-96601135 CCACCATGCCCGGCTACAACAGG - Intronic
935710746 2:105896177-105896199 CCATCGTGCCTGGCTTAAACAGG - Intergenic
935732288 2:106074060-106074082 GCTGCAGGCCTGGCTTCCACAGG + Intronic
937323196 2:120973219-120973241 GCACGATGCATGGTTTCCACGGG + Intronic
937586549 2:123558354-123558376 CCACCATGCCTGCCTTCAAATGG + Intergenic
938721279 2:134069265-134069287 CCACCATGCCTGGCTGCCACTGG - Intergenic
938798776 2:134740842-134740864 CCACCGTGCCTGGCCTCATCTGG - Intergenic
938924773 2:136028998-136029020 CCACCATGCCTGGCCTTAATTGG + Intergenic
941965311 2:171294908-171294930 GAACCATGCCTTGCTCCCACTGG - Intergenic
941968958 2:171329136-171329158 CCACCATGCCTGGCTACAGGAGG + Intronic
942025614 2:171907826-171907848 CCACCACGCCTGGCCTCCACTGG + Intronic
942666391 2:178323748-178323770 CCACCATGCCTGGCCGCCACTGG + Intronic
943704212 2:191017912-191017934 CCACTGTGCCTGGCCTCAACTGG + Intronic
944159801 2:196646226-196646248 TCACCATTCCTGAGTTCAACAGG + Intronic
944958348 2:204838500-204838522 CCACCATGCCTGGCTGCATCAGG + Intronic
945095669 2:206216567-206216589 CCACCATGCCTGGTCTCAACAGG + Intronic
945360390 2:208889286-208889308 GCACCCTGCCTAACATCAACTGG + Intergenic
947729590 2:232420580-232420602 GCTCCACTCCTGGCTTCAACAGG + Intergenic
947741625 2:232487439-232487461 GAGCCACTCCTGGCTTCAACAGG + Intronic
1168760136 20:344881-344903 CCACCGTGCCTGGCCTCATCTGG + Intergenic
1169728946 20:8765964-8765986 CCACCATGCCTGCCCACAACTGG + Intronic
1170640307 20:18146249-18146271 CCACCATGTCTGGTTTCATCTGG - Intronic
1170785923 20:19467591-19467613 CCACCATGCCTAGCCTCAAAGGG - Intronic
1171186920 20:23129312-23129334 GCACCATCCCTGGCTGCAGAGGG + Intergenic
1171371951 20:24668135-24668157 GCCCCATGGCTGCCTTCAGCTGG - Intergenic
1172309575 20:33907380-33907402 CCACCATGCCTGGCTCTAATTGG + Intergenic
1172700857 20:36852767-36852789 CCACCATGCCCGGCCTCATCAGG - Intronic
1173871647 20:46345765-46345787 CCACCATGCCTGGCTTCTGCAGG - Intergenic
1174830109 20:53804622-53804644 CCACCATGCCTGGCCTTATCAGG + Intergenic
1174910270 20:54600576-54600598 GCAGCATGCCTGGATTCCACAGG - Intronic
1175383790 20:58581295-58581317 CCACCATGCCTGGCCTTAATTGG + Intergenic
1175626277 20:60490603-60490625 GCACCAGCCCTGGCTGCAGCTGG - Intergenic
1176155876 20:63620184-63620206 GCACCATGCCTGGCCTGCCCCGG + Intronic
1178019174 21:28389641-28389663 CCACCACGCCTGGCCTCAAAAGG + Intergenic
1178564361 21:33669368-33669390 CCACCATGCCTGGCCCAAACTGG + Intronic
1179421436 21:41239728-41239750 GCTCCATGCCTGATTTCAAAGGG - Intronic
1179971289 21:44837721-44837743 GCTCCAAGCCGGGCTCCAACGGG - Intergenic
1180678975 22:17609976-17609998 CCACCATGCCTGGCCTCAGAGGG - Intronic
1180872982 22:19157746-19157768 CCAGCATGCCTGGCTTCAGCTGG + Intergenic
1181617955 22:24067831-24067853 GCACCATGCCTGGCACTAGCAGG + Intronic
1182239727 22:28906035-28906057 CCACCATGCTTAGCCTCAACAGG - Intronic
1182262107 22:29080804-29080826 GCAGCATCCCTGGCCTCTACCGG - Intronic
1182588719 22:31362652-31362674 ACACCATGCCCGGCTCCAAAGGG + Intergenic
1182637086 22:31736749-31736771 CCACCATGCCTGGCCTCATATGG - Intronic
1182846484 22:33435287-33435309 CCACCATGCCTGGCTCCTACGGG + Intronic
1183119155 22:35716547-35716569 CCACCGTGCCTGGCTTCTATTGG + Intergenic
1183399459 22:37593563-37593585 CCACCATGCCTGGCCTATACTGG + Intergenic
1183424760 22:37733474-37733496 GCCCCCTGCCTGGCTTCTAGCGG - Intronic
1184207822 22:43016050-43016072 TCACCATGCCTGGCTCTATCTGG - Intergenic
1184563982 22:45280340-45280362 CCACCGTGCCTGGCCTCAGCAGG - Intergenic
949556334 3:5156701-5156723 CCACCATGCCCGGCCTCAAATGG + Intronic
951215590 3:20021895-20021917 CCACCATGCCTGGCCTCAGTTGG - Intergenic
952862255 3:37822742-37822764 CCACCATGCTAGGGTTCAACAGG - Exonic
952933486 3:38377386-38377408 GCACAATGCCTGGCACCAAATGG - Intronic
953374352 3:42416284-42416306 GCACCATGCCCTGCTTTAATTGG + Intergenic
954473696 3:50723058-50723080 CCACCATGCCTGGCCTCAGATGG + Intronic
955903777 3:63785357-63785379 CCACCGTGCCTGGCCTCCACTGG + Intergenic
959859775 3:111204263-111204285 CCACCTTGCCTGACTTCAAGGGG - Intronic
960453258 3:117837230-117837252 CCACCATGCCTGGCTCAATCAGG - Intergenic
960813553 3:121649520-121649542 CCACCACGCCTGGCCTAAACAGG + Intronic
961103679 3:124222890-124222912 CTACCATGCCTGGCCTCACCTGG + Intronic
961162347 3:124739619-124739641 CCACCATGCCCAGCTTCAAGAGG + Intronic
961311500 3:126004757-126004779 GCTCCATGCAAGGCTGCAACTGG - Intergenic
961713572 3:128844709-128844731 TCCCCAGGCCTGGCTTCCACTGG - Intergenic
962525612 3:136235029-136235051 CCACCATGCATGGCCTCAATGGG - Intergenic
963210164 3:142680350-142680372 CCACCATGCCTGGCCAAAACTGG + Intronic
963750391 3:149171990-149172012 CCACCACGCCTGGCCTGAACTGG + Intronic
964191189 3:154002962-154002984 GCACGATGCCTGGATACAACTGG + Intergenic
965600002 3:170445217-170445239 CCACCGTGCCTGGCCTGAACTGG - Intronic
966921793 3:184616888-184616910 GCAGCATGACTGTCTTCCACGGG - Intronic
967160860 3:186736761-186736783 CTACCACGCCTGGCCTCAACTGG - Intronic
967829391 3:193905744-193905766 GCATGAGGCCTGGCTTCAATAGG + Intergenic
968207577 3:196817638-196817660 CCACCATGCCTGGCCTCCCCTGG + Intronic
968401269 4:300173-300195 CCACCATGCCTGGCCACAAATGG - Intronic
968630262 4:1647045-1647067 CCACCATGCCCGGCTTTTACTGG - Intronic
970370373 4:15399843-15399865 GAGCAATGCCTGGCTTCAAGTGG - Intronic
970603651 4:17659771-17659793 CCACCGTGCCTGGCTGCAACAGG + Intronic
973741239 4:53921439-53921461 CCACCACGCCTGGCCTCAACTGG + Intronic
974004036 4:56537978-56538000 CCACCGTGCCTAGCTTCACCTGG + Intronic
975100405 4:70506713-70506735 GCACCATGCTTGGCTCCTAGTGG - Intergenic
975636805 4:76458078-76458100 TCACCACGCCTGGCTGCACCCGG + Intronic
978391495 4:108230911-108230933 GCACCGTGCCTGGCCCCAATAGG + Intergenic
978935115 4:114365033-114365055 GCACCATTGCTGGCTTCAAGAGG - Intergenic
981375275 4:144007923-144007945 CCACCATGCCTGGCTTAGAATGG + Intronic
982251197 4:153407986-153408008 GCACCATGCCTGGCTTTCAGTGG - Intronic
982272750 4:153607958-153607980 CCACCATGCCTGGCTACATTTGG - Intronic
982367620 4:154597450-154597472 CCACCATCCCTGGCCCCAACAGG - Intergenic
982664610 4:158245990-158246012 CCACCATGCCTGGCTAGAAGGGG - Intronic
982707275 4:158723755-158723777 GTACAATGCCTGGCATAAACTGG + Intergenic
982764176 4:159324313-159324335 CCACCATGCCTGGCACCAATAGG + Intronic
983211489 4:164963091-164963113 CCACCATGCCTGGCTTCTCTGGG - Intronic
983841672 4:172464418-172464440 ACACCATGCCTGGCCTCATTCGG - Intronic
984326942 4:178267276-178267298 GCACCATGCCTGGCCTATATAGG + Intergenic
985558970 5:572160-572182 GGACCATGCTTGGTTTCAATTGG + Intergenic
986287709 5:6372284-6372306 GCAGCTTGTCTGGCGTCAACTGG - Exonic
987031627 5:13981362-13981384 GCACCGTGCCTGGCTTAGAGTGG + Intergenic
989241728 5:39209993-39210015 GCACCAGGCCCCTCTTCAACAGG + Intronic
990254893 5:53957546-53957568 TCACCATGCCTGGCTCCATTTGG - Intronic
990467977 5:56087469-56087491 CCACCATGCCTGGCCTCCAATGG - Intergenic
990714494 5:58621861-58621883 CCACCACGCCTGGCCTCAAGTGG + Intronic
991063358 5:62401206-62401228 CCACCATGCCCAGCCTCAACAGG - Intronic
991716476 5:69455338-69455360 CCACCGTGCCTGGCCTCAAATGG + Intergenic
992657442 5:78924165-78924187 GCACCAGGCCTGGCATAAGCAGG - Intronic
993731503 5:91428381-91428403 CCACCATGCCGGGCTTCAAATGG - Intergenic
994115229 5:96054404-96054426 CCACCATGCCTGGCTTGTCCTGG + Intergenic
994660794 5:102651552-102651574 GGACAATGTCAGGCTTCAACGGG + Intergenic
994688200 5:102983156-102983178 CCACCATGCCTGGCCTTACCGGG - Intronic
995380186 5:111523106-111523128 CCACCATGCCTGGCTGAGACAGG - Intergenic
997451515 5:133987388-133987410 CCACCACGCCTGGCTACAAATGG - Intronic
997487536 5:134244029-134244051 CCACCATGCCTGGCTCCACCAGG + Intergenic
998110002 5:139493983-139494005 CCACCGTGCCTGGCCTCAAAAGG - Intergenic
998432557 5:142078653-142078675 TCACCAAGCCTCGCTTCAAAGGG - Intergenic
1000332188 5:160214591-160214613 CCACCATGCCTGGCCTCAAGTGG + Intronic
1001048123 5:168391245-168391267 CCACCAAGCCTGGCTTCAACTGG - Intronic
1001426712 5:171627730-171627752 CCACCATGCCCGGCCTCAACTGG + Intergenic
1001449278 5:171811786-171811808 TCACCTTGCTTGGCTTCCACTGG + Intergenic
1001652222 5:173324087-173324109 GCACCCTGCCTGGCAGCATCTGG + Intronic
1001921293 5:175602035-175602057 CCACCATGCCTGGCTACCATAGG + Intergenic
1002003120 5:176209676-176209698 CCACCATGCCTGGCATAGACTGG + Intergenic
1002223344 5:177701274-177701296 CCACCATGCCTGGCATAGACTGG - Intergenic
1003207774 6:4029169-4029191 CCACCATGCCTGGCTCCACTTGG + Intronic
1004282298 6:14291055-14291077 GCACCAAGCGTGGCCTCATCAGG - Intergenic
1004373699 6:15074239-15074261 GCAGAAGGCCTGGCTTCAATGGG + Intergenic
1006130168 6:31864361-31864383 CCACCATGCCTGGCCTCTAATGG + Intronic
1006265876 6:32923076-32923098 CCACCATGCCTGGCCTGAACTGG - Intergenic
1007714084 6:43844333-43844355 CCACCATGCCTGGCCTCAATAGG + Intergenic
1007727886 6:43927648-43927670 CCACCAGGCCTTGCTACAACTGG + Intergenic
1009909860 6:69912798-69912820 CCACCGTGCCTGGCCTCTACTGG - Intronic
1009953095 6:70419131-70419153 CCACCATGCCTGGCCAAAACAGG - Intronic
1011406119 6:87017392-87017414 CCACCACGCCCGGCTGCAACTGG - Intergenic
1011425692 6:87226965-87226987 CCACCATGCCTGGCTTTAATGGG + Intronic
1011630648 6:89320751-89320773 CCACCATGCCTGGCCTCAATAGG - Intergenic
1012458791 6:99436810-99436832 CCACCATGCCCAGCCTCAACTGG - Intronic
1013120391 6:107135600-107135622 CCACCATGCCCGGCTAAAACAGG + Intergenic
1013528603 6:110998339-110998361 GCAAAATGGCTGACTTCAACTGG - Intronic
1013609543 6:111781373-111781395 GCATCATGCCTGGCATACACTGG + Intronic
1013773612 6:113653728-113653750 GCATCATTCCTGCCTTCAAGGGG + Intergenic
1013779578 6:113715165-113715187 CCACCACGCCTGGCTTAACCAGG - Intergenic
1015177250 6:130323513-130323535 CCACCATGCCTGGCCTGGACAGG - Intronic
1017193051 6:151673593-151673615 CCACCATGCCTGGCTTAATTTGG - Intronic
1017566716 6:155695051-155695073 CCACCACGCCTGGCTTCAAAAGG - Intergenic
1017999599 6:159567409-159567431 CCACCATGCCTGGCTGTACCAGG + Intergenic
1018050397 6:160004420-160004442 CCACCATGCCAGGCTGCACCAGG - Intronic
1020256790 7:6506968-6506990 CCACCAAGCCTGGCCTCAATGGG + Intronic
1021132429 7:16927352-16927374 GCAACCTGCCTGGCTTCTTCTGG + Intergenic
1021154047 7:17187341-17187363 GCACCCTGCCTGCCATCAAGTGG + Intergenic
1021224828 7:18014603-18014625 CCACCATGCCTGGCCTCACTGGG + Intergenic
1021272400 7:18605965-18605987 CCACCATGCCTGGCTGCCCCTGG + Intronic
1023049980 7:36242633-36242655 CCACTACGCCTGGCCTCAACTGG - Intronic
1023060715 7:36323313-36323335 CCACCATGCCTGGCCTCAGAGGG - Intergenic
1023580523 7:41677497-41677519 CCACCATGCCTGGCCCCCACCGG - Intergenic
1023774863 7:43595561-43595583 GCACCATGCCTGGCTTCAACTGG + Intronic
1025243342 7:57296611-57296633 CCACCATGCCTGGCCTCGCCCGG - Intergenic
1025950656 7:66142782-66142804 CCACCGTGCCTGGCTTCTCCTGG + Intronic
1028277836 7:88879749-88879771 CCACCATGCCTGCCTTCAAGTGG - Intronic
1028615618 7:92763654-92763676 GCACCACACCTGACTTCACCTGG + Intronic
1029200583 7:98836647-98836669 CCACCGTGCCCGGCCTCAACTGG + Intergenic
1029331645 7:99861159-99861181 CCACCATGCCTGGCCTAAACAGG + Intronic
1030259175 7:107544233-107544255 CCACAATGCCTGGCTTTCACTGG - Intronic
1030829521 7:114203629-114203651 CCACCATGCCTGGCAGCACCTGG + Intronic
1032025342 7:128437205-128437227 CGACCATGCCCGGCTACAACTGG + Intergenic
1032599391 7:133277112-133277134 CCACCACGCCTGGCTATAACTGG + Intronic
1032746445 7:134791476-134791498 GGACCATGCCCGGCCACAACAGG + Intronic
1033786703 7:144740431-144740453 CCACCATGCCTGGCCTCTACTGG - Intronic
1034904286 7:154930192-154930214 CCACCATGCCTGGCTGAAATTGG + Intronic
1035739707 8:1917419-1917441 CCTCCATGCCTGGGTTCAAGGGG - Intronic
1035960287 8:4128921-4128943 CCACCATGCCCGGCTAAAACAGG - Intronic
1036065835 8:5380476-5380498 CCACCATGCCTGCCATCAACAGG - Intergenic
1036978620 8:13443370-13443392 CCACCATGCCTGGCCTCATTTGG - Intronic
1037181722 8:16014933-16014955 GCACAATGGCTGCCTTCAATGGG - Intergenic
1037524265 8:19709338-19709360 GCATCAGGCCTGCCTTCAAGGGG + Intronic
1038656874 8:29460869-29460891 CCACTGTGCCTGGCCTCAACTGG - Intergenic
1039010535 8:33088628-33088650 GAAGCATGGCTGGCTTCAAAAGG + Intergenic
1039797444 8:40927246-40927268 GCACCATGCCTGGCTTTCCAAGG + Intergenic
1040349819 8:46553383-46553405 CCACCATGCCTGGCTCCAGTTGG - Intergenic
1040367947 8:46738865-46738887 CCACCATGCCTGGCCTCAGTTGG + Intergenic
1040891080 8:52316877-52316899 TGACCATGCTTGGCTTCAAAGGG + Intronic
1042337874 8:67647461-67647483 ACACCATGCCTGGATTTGACAGG + Intronic
1042954463 8:74234205-74234227 GCACCTTGGATGGCTTCAAAGGG + Intergenic
1043613287 8:82092569-82092591 CCACCATGCCTGGCCTGAATGGG - Intergenic
1043889918 8:85643664-85643686 GCTCCATGCCCGGCCTCAGCAGG - Intergenic
1043891456 8:85655572-85655594 GCTCCATGCCCGGCCTCAGCAGG - Intergenic
1043892529 8:85662409-85662431 GCTCCATGCCCGGCCTCAGCAGG - Intergenic
1043893028 8:85714926-85714948 GCTCCATGCCCGGCCTCAGCAGG + Intergenic
1043895715 8:85736380-85736402 GCTCCATGCCCGGCCTCAGCAGG + Intergenic
1043896964 8:85745428-85745450 GCTCCATGCCCGGCCTCAGCAGG - Intergenic
1043899288 8:85763795-85763817 GCTCCATGCCCGGCCTCAGCAGG - Intergenic
1043900898 8:85775989-85776011 GCTCCATGCCCGGCCTCAGCAGG - Intergenic
1043902862 8:85791264-85791286 GCTCCATGCCCGGCCTCAGCAGG - Intergenic
1043904472 8:85803457-85803479 GCTCCATGCCCGGCCTCAGCAGG - Intergenic
1043906084 8:85815648-85815670 GCTCCATGCCCGGCCTCAGCAGG - Intergenic
1043907692 8:85827838-85827860 GCTCCATGCCCGGCCTCAGCAGG - Intergenic
1045213912 8:100127933-100127955 CCACCATGCCTGGCCTAAGCCGG + Intronic
1045911804 8:107418783-107418805 CCACCATGGCTGGCCCCAACTGG - Intronic
1047206585 8:122807146-122807168 GGACAATGCCTGGCTCCTACTGG + Intronic
1047769477 8:128019131-128019153 GCACCGTGGCTGCCTTCAGCTGG - Intergenic
1047791410 8:128207362-128207384 GCACCTTGCCTGCCCTCAACGGG + Intergenic
1048274263 8:133054036-133054058 GCACCAGGCCTTGCTTAAAATGG - Intronic
1048884821 8:138901652-138901674 CCACCATGCCTGGCCTTTACTGG + Intronic
1050062412 9:1723572-1723594 GCAACCTGCCTGGCTTCAACAGG + Intergenic
1051132192 9:13875289-13875311 GCAGCATGCATGGCATCAAGTGG + Intergenic
1051444464 9:17125726-17125748 CCACCGTGCCTGGCCTCAAAGGG + Intergenic
1053066920 9:35075499-35075521 GGGCCAGGCCTGGGTTCAACTGG - Exonic
1053318188 9:37070861-37070883 CCACCATGCCTGGCCTGCACTGG + Intergenic
1056514002 9:87333129-87333151 CCACCATGCCTGACTTCTACAGG - Intergenic
1057525742 9:95798955-95798977 CCACCTTGCCTGGCCCCAACTGG - Intergenic
1057811254 9:98258478-98258500 CCACCATGCCTGGCCTCGATAGG + Intergenic
1057995207 9:99816728-99816750 CCACCATGCCTGGCTGGAATAGG - Intergenic
1059156694 9:111995810-111995832 CCACCATGCCTGGCCTCTAAAGG - Intergenic
1061675864 9:132215291-132215313 CCACCATGCCTGGCCCCCACTGG - Intronic
1062072343 9:134563388-134563410 CCACCATGCCTGGCTACACTGGG + Intergenic
1062420010 9:136476111-136476133 GCACCATGCCTGGGCACAGCTGG + Exonic
1185691142 X:2156118-2156140 CCACCATGCCTGGCCTCAAGGGG - Intergenic
1187188784 X:17013135-17013157 GCAGCATCCCTGGCCTCTACCGG - Intronic
1187343004 X:18438349-18438371 CCACCATGCCTGGCCTGAAGAGG + Intronic
1187379257 X:18785593-18785615 CTACCATGCCTGGCTGCAACTGG - Intronic
1187587458 X:20679268-20679290 CCACCATGCCTGGCCTCAATTGG + Intergenic
1188223937 X:27574119-27574141 CCACCATGCCTGGCTTCAGTGGG + Intergenic
1189345420 X:40237516-40237538 CCACCATGCCTGGCTAAAAGTGG + Intergenic
1189746430 X:44173288-44173310 GCTCCATGCCTGCCTCCCACGGG + Intronic
1190085610 X:47392866-47392888 CCACCATGCCCGGCCTCAACAGG - Intronic
1190599657 X:52077364-52077386 CCAACAAGCATGGCTTCAACAGG - Intergenic
1190608537 X:52170486-52170508 CCAACAAGCATGGCTTCAACAGG + Intergenic
1194489671 X:94530691-94530713 CCAGCATCCCTGGCTCCAACAGG - Intergenic
1194721312 X:97343379-97343401 CCACCATGCCTGGATTCCTCTGG - Intronic
1194977671 X:100410150-100410172 GCACCATGCCTGGCTTGCCCGGG - Exonic
1195004148 X:100670057-100670079 CCACCATGCCTGGCCGCAAAAGG + Intronic
1195289016 X:103413890-103413912 GCACACTGCTTGGCTGCAACAGG + Intergenic
1196804365 X:119571509-119571531 CCACCATGCCTGGCCTCAAAAGG + Intergenic
1197608711 X:128614519-128614541 GCACCATATCTGGCTTCTGCAGG + Intergenic
1198558904 X:137826882-137826904 CCATCATGCCTGGCTTCTACTGG - Intergenic
1201354218 Y:13081301-13081323 GCAGCCTGCTTGGCTTGAACTGG + Intergenic