ID: 1023777301

View in Genome Browser
Species Human (GRCh38)
Location 7:43620091-43620113
Sequence CTTCTATGGAGCCTCAGACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 111}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023777301_1023777309 26 Left 1023777301 7:43620091-43620113 CCAAGTCTGAGGCTCCATAGAAG 0: 1
1: 0
2: 2
3: 10
4: 111
Right 1023777309 7:43620140-43620162 GATCCATGGTTGAGTGCTTCTGG 0: 1
1: 0
2: 1
3: 5
4: 60
1023777301_1023777304 -8 Left 1023777301 7:43620091-43620113 CCAAGTCTGAGGCTCCATAGAAG 0: 1
1: 0
2: 2
3: 10
4: 111
Right 1023777304 7:43620106-43620128 CATAGAAGTGTGGAGCAGAGAGG No data
1023777301_1023777306 0 Left 1023777301 7:43620091-43620113 CCAAGTCTGAGGCTCCATAGAAG 0: 1
1: 0
2: 2
3: 10
4: 111
Right 1023777306 7:43620114-43620136 TGTGGAGCAGAGAGGGCATTTGG 0: 1
1: 0
2: 3
3: 32
4: 384
1023777301_1023777307 4 Left 1023777301 7:43620091-43620113 CCAAGTCTGAGGCTCCATAGAAG 0: 1
1: 0
2: 2
3: 10
4: 111
Right 1023777307 7:43620118-43620140 GAGCAGAGAGGGCATTTGGTTGG 0: 1
1: 0
2: 1
3: 25
4: 305
1023777301_1023777305 -7 Left 1023777301 7:43620091-43620113 CCAAGTCTGAGGCTCCATAGAAG 0: 1
1: 0
2: 2
3: 10
4: 111
Right 1023777305 7:43620107-43620129 ATAGAAGTGTGGAGCAGAGAGGG No data
1023777301_1023777308 12 Left 1023777301 7:43620091-43620113 CCAAGTCTGAGGCTCCATAGAAG 0: 1
1: 0
2: 2
3: 10
4: 111
Right 1023777308 7:43620126-43620148 AGGGCATTTGGTTGGATCCATGG 0: 1
1: 0
2: 4
3: 8
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023777301 Original CRISPR CTTCTATGGAGCCTCAGACT TGG (reversed) Intronic
900487408 1:2929925-2929947 CTTCCATGGAGCCTGTGTCTGGG + Intergenic
901680390 1:10909655-10909677 GTTCTGTGGAGCCTCAGAGGGGG - Intergenic
903260814 1:22130910-22130932 CTTCTATGGAACTTGGGACTGGG + Intronic
905479683 1:38252837-38252859 CTTCTCTGGAGACTGTGACTGGG + Intergenic
906847919 1:49214387-49214409 CTTTTATTTAGCCTCAGACTTGG - Intronic
910982103 1:92968448-92968470 CTTCTTTGAAGCTTCAGAATGGG + Intergenic
915237296 1:154493323-154493345 TTTCTATGGCGCCTCAGGTTTGG - Intronic
915603943 1:156939162-156939184 CTTCTCAGGAGCCTCAGGCCGGG - Intronic
915972510 1:160364608-160364630 CTGCTAGGGAGACACAGACTTGG - Intergenic
918520013 1:185405168-185405190 CTTATATGAAGCCTGAGACATGG + Intergenic
920054916 1:203184697-203184719 CTTCTATGGCCTCTCAGACATGG - Intronic
920279717 1:204833685-204833707 CTTCATTGGTGCCTCAGACCTGG + Intronic
921782107 1:219177139-219177161 CTACCCTGGAGCCTCCGACTTGG - Intronic
922968967 1:229718057-229718079 CTTCTATGGAAACAAAGACTTGG + Intergenic
924144426 1:241059309-241059331 TTTCTGTTGAGCTTCAGACTTGG + Intronic
1064455535 10:15484228-15484250 CTTCCATGGGTCCTCAGACATGG - Intergenic
1064917310 10:20474311-20474333 CAGTTCTGGAGCCTCAGACTAGG - Intergenic
1075212621 10:120503723-120503745 CTTCTATGCACCCTCAGGGTGGG - Intronic
1077797916 11:5510130-5510152 CTTCTGTGGAGGCTCAGACTGGG + Intronic
1078564711 11:12404482-12404504 CTTCTGTGGAGGCTCTGATTGGG - Intronic
1078765656 11:14294944-14294966 CCTCTAGAGAGCCTCATACTTGG + Intronic
1079024716 11:16937476-16937498 ATTATATGGCTCCTCAGACTGGG - Intronic
1079469560 11:20765426-20765448 CTTCCATGCAGCCTCACACTAGG + Intronic
1080311257 11:30895378-30895400 CTTCTGTTGTGCCTCAGACTAGG - Intronic
1083492135 11:63020979-63021001 CTGCTAAGGAGCGTCAGCCTGGG - Intergenic
1084671093 11:70607095-70607117 CTTCTGTGGCCCCTCAGACGGGG + Intronic
1087561408 11:99795744-99795766 ATTTTATGGGGTCTCAGACTCGG + Intronic
1091075749 11:132614420-132614442 CTGCTATGGAGCCTCAAGCAAGG - Intronic
1096615794 12:52832888-52832910 CTTCTATGAAGACTCAGAAATGG - Intronic
1096670263 12:53194255-53194277 CTTCTCAGGACCCTCACACTGGG + Exonic
1098901128 12:76112938-76112960 CATCCAAGGAGCCTTAGACTTGG + Intergenic
1100269045 12:93006193-93006215 CTTCTCTGATGCCTCTGACTGGG - Intergenic
1103356070 12:120321515-120321537 CTCCTATTGAGCCTCAGCTTAGG + Intergenic
1104102096 12:125622419-125622441 CTTCTGTGTGGCCTCAGACCTGG - Intronic
1104974208 12:132545134-132545156 CTTCTTTGGAGCCTGAGTCTTGG + Intronic
1109792956 13:67273898-67273920 CCTCCGGGGAGCCTCAGACTTGG - Intergenic
1112600728 13:100853331-100853353 CTTCTCTAGAGCCCCAAACTTGG - Intergenic
1114377503 14:22163909-22163931 CTGCTTTGGGGACTCAGACTGGG + Intergenic
1115194322 14:30779638-30779660 TTTCTATGGAGTCTCTTACTAGG + Intergenic
1115542849 14:34438958-34438980 CTTCTGTGGATCCTAAGATTTGG - Intronic
1118588181 14:67376937-67376959 CTTCCATGTAGCCTTAGCCTGGG + Intronic
1119077123 14:71652131-71652153 CTTCTTTGGGGCTTCAGAGTAGG - Intronic
1121736941 14:96225336-96225358 TTGCTATAGAGTCTCAGACTAGG + Intronic
1122634858 14:103125009-103125031 CAGCCATGGAGGCTCAGACTGGG - Intronic
1124024601 15:25953922-25953944 ATTGCAGGGAGCCTCAGACTGGG - Intergenic
1129758682 15:78114162-78114184 CTTCCAGGGAGCCTCTGACGTGG - Intronic
1130640384 15:85668035-85668057 CTTGTATGGAACCTCAGAGTAGG + Intronic
1131946386 15:97626773-97626795 CTTCTATGCAACATCATACTTGG + Intergenic
1135376572 16:21952714-21952736 ATTCTATGTAGCCCCAGCCTAGG + Exonic
1138334740 16:56244284-56244306 CTTTTATCCAGCCTAAGACTTGG - Intronic
1138505445 16:57476063-57476085 CTTCCCTGGAGCCCCAGCCTGGG + Intronic
1138874169 16:60928823-60928845 TTTCTCTGGAGCCTCCAACTGGG + Intergenic
1140965615 16:79963485-79963507 CTTCCAAAGAGCCGCAGACTGGG + Intergenic
1146000548 17:29127966-29127988 CTTCTTTGGGGCTTCAGGCTTGG + Intronic
1148500951 17:48090758-48090780 CTTCCCTAGAGCCCCAGACTGGG + Intronic
1151517089 17:74603500-74603522 CTTCTCTTGAGTCTCAGCCTGGG - Intergenic
1156228802 18:35134295-35134317 CTTAAAAGGTGCCTCAGACTTGG - Intronic
1157683629 18:49626196-49626218 CTCCTATGCAGCCTGAGACGTGG - Intergenic
1158396366 18:57081202-57081224 CTTTGATGGAGCCTCAGAATTGG - Intergenic
1161577324 19:5061539-5061561 CTTTCATGGAGCCTCATCCTGGG - Intronic
1161851149 19:6738785-6738807 TTTCTCTGCAGCCTCAGACAAGG - Intronic
1162552599 19:11365834-11365856 GTTTCATGGAGCTTCAGACTTGG + Intergenic
1165700483 19:37933470-37933492 CTTCTATGGAGCCTAGAGCTGGG - Intronic
1166727303 19:45036752-45036774 CTTCGCTGCAGCCTCAAACTGGG + Intronic
926781068 2:16472313-16472335 ATTCTATGGAATCTCAGATTAGG + Intergenic
937392824 2:121506252-121506274 CTTTTAGGGAGCTCCAGACTTGG - Intronic
940254324 2:151713131-151713153 CTTCCATGGGGCCACAAACTGGG + Intronic
940829680 2:158453989-158454011 TTTCTGTGGATCCTCAGGCTAGG + Intronic
943627982 2:190219932-190219954 CTTCTCTGGAGTCACAGAGTAGG - Intronic
1169042768 20:2509290-2509312 GTGCTATGGAGCCTCAGCCCAGG - Intronic
1169556142 20:6752419-6752441 CTTCTCGGGAGGCTCAGGCTGGG - Intergenic
1169787152 20:9371117-9371139 CTACTATGGAGAGTGAGACTAGG - Intronic
1170687196 20:18580145-18580167 ATTCAATGAGGCCTCAGACTTGG - Intronic
1170982982 20:21232177-21232199 TTTCTTTGGAGCCAGAGACTTGG - Intronic
1174532624 20:51226078-51226100 CTTCTATGCAAACTAAGACTTGG + Intergenic
1178053678 21:28775592-28775614 CTTCCATGGAGCCTCATTCTGGG - Intergenic
1178399541 21:32273409-32273431 CTTCTATGTAGCTTCAGGATTGG - Intronic
1179644462 21:42767099-42767121 CTGCTACGGAGCCCCAGACGGGG + Intronic
1182081484 22:27532348-27532370 CTACTGTGGAGACTCAGCCTGGG - Intergenic
1183041072 22:35178411-35178433 CTTCTGTGGAGTCTCAGGGTTGG + Intergenic
953360130 3:42288600-42288622 CTCCCCTGGAGCATCAGACTGGG - Intergenic
956508597 3:69970439-69970461 CTGCTATTGAGCCTCAGATGTGG - Intergenic
957441509 3:80254003-80254025 TTTCTATGGAGCCAAAAACTTGG - Intergenic
958530881 3:95329165-95329187 CTTCCATGGAAGCTCAGAATGGG - Intergenic
961717375 3:128867224-128867246 CTTCTCTGAAGTCTCAGAGTTGG + Intergenic
963838836 3:150083996-150084018 TTTCTATAGAGCCTAAGACTTGG - Intergenic
966659486 3:182398538-182398560 CTTCTGAGGAACCTCAGCCTGGG + Intergenic
968299727 3:197603387-197603409 CTTCTTTAGAGCCACAGGCTGGG - Intergenic
973748832 4:53991611-53991633 CCTCTATGGACCCTAAAACTAGG - Intronic
975379557 4:73682931-73682953 CTTATATCTAGCCTCAGCCTTGG - Intergenic
982144214 4:152365097-152365119 CTTCTGTGAACCCACAGACTAGG - Intronic
983295601 4:165864359-165864381 CTCCTATAGAAACTCAGACTGGG + Intergenic
990370663 5:55114899-55114921 AATCTCTGGAACCTCAGACTGGG - Intronic
992028291 5:72693139-72693161 CTTCTATGGAGAGTGAGATTAGG - Intergenic
995269664 5:110206241-110206263 CTGGTATGGAGCCACTGACTTGG - Intergenic
997261993 5:132472369-132472391 CTTTTGTGGAGCCACACACTGGG - Intronic
999258728 5:150224578-150224600 ATTCTATGGTGCCTAAGACTTGG - Intronic
999656139 5:153812248-153812270 CTTCTATGGAGCCTCTGACATGG + Exonic
1000050935 5:157562408-157562430 CTCCTCTGGAGCCTCAGTGTGGG + Intronic
1005336618 6:24802927-24802949 CTTCAAGGGATCCTCAGCCTTGG + Intronic
1006749848 6:36370136-36370158 ATTCTATGAAGCCACAGAGTGGG - Intronic
1007401230 6:41603688-41603710 CTTCTCTGGAGGCTCCGAGTGGG + Intergenic
1010071021 6:71745749-71745771 CTTCTCAGGAGGCTCAGGCTGGG + Intergenic
1010925488 6:81740103-81740125 CTTCTAAGGGGCATCGGACTAGG + Intronic
1012376066 6:98563097-98563119 CCTCTATGGAGTCTCAAACATGG + Intergenic
1012739257 6:102993617-102993639 CTTCTCTGGACACTCAGCCTAGG - Intergenic
1014143641 6:117971795-117971817 CCTCTATGTAGCCCCAGACATGG - Intronic
1021953426 7:25797984-25798006 CTTCTTTGGAGCATCAGGCTGGG - Intergenic
1022925182 7:35049630-35049652 CTTCTCTGGAGCCCCAGAACAGG + Intergenic
1023777301 7:43620091-43620113 CTTCTATGGAGCCTCAGACTTGG - Intronic
1029823202 7:103164334-103164356 CTTCTCTGGAGCCCCAGAACAGG + Intergenic
1031989692 7:128189543-128189565 CCTCTAAGGAGCCCCAGACCTGG - Intergenic
1032166574 7:129549961-129549983 CTACTCTGGAGTCTGAGACTGGG - Intergenic
1036679299 8:10859225-10859247 CTTCTCTGGAGCCTGAGTCAGGG + Intergenic
1049014291 8:139908567-139908589 CTCCTTTGAAGCCTGAGACTCGG + Intronic
1049724413 8:144138822-144138844 CTAGTGTGGAGCCTCAGAGTTGG + Intronic
1052327903 9:27236250-27236272 CTTCTATTGAACCTAATACTAGG + Intergenic
1052986723 9:34493312-34493334 CATCTATGGAGTCTCAGGTTTGG + Exonic
1057455659 9:95207595-95207617 GTTCTAGGGAGCATCAGTCTAGG - Intronic
1059581515 9:115554674-115554696 CTTAGATGAAGCCTCAGATTTGG + Intergenic
1061776758 9:132970783-132970805 CATCTCTGCAGCCTCAGAGTGGG + Intronic
1187098282 X:16168690-16168712 CTTCAATGGGACCTCAGATTTGG - Intronic
1189254433 X:39626972-39626994 CTTCTAGGCTGCCTCAGACGTGG - Intergenic
1197442471 X:126509123-126509145 CTTCTAGGTAGCTTCAGAATAGG - Intergenic