ID: 1023777309

View in Genome Browser
Species Human (GRCh38)
Location 7:43620140-43620162
Sequence GATCCATGGTTGAGTGCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 60}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023777303_1023777309 12 Left 1023777303 7:43620105-43620127 CCATAGAAGTGTGGAGCAGAGAG 0: 1
1: 0
2: 4
3: 11
4: 222
Right 1023777309 7:43620140-43620162 GATCCATGGTTGAGTGCTTCTGG 0: 1
1: 0
2: 1
3: 5
4: 60
1023777301_1023777309 26 Left 1023777301 7:43620091-43620113 CCAAGTCTGAGGCTCCATAGAAG 0: 1
1: 0
2: 2
3: 10
4: 111
Right 1023777309 7:43620140-43620162 GATCCATGGTTGAGTGCTTCTGG 0: 1
1: 0
2: 1
3: 5
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023777309 Original CRISPR GATCCATGGTTGAGTGCTTC TGG Intronic
904482388 1:30802087-30802109 GATCCCTGGTTGAGTTTTGCAGG - Intergenic
915085955 1:153389055-153389077 GAACCCTGGTTTAGTGATTCTGG + Intergenic
923764681 1:236882195-236882217 GGTCCATGGCTGAGTGCTGTGGG + Intronic
1076625143 10:131817092-131817114 GAGCTATGCTTGACTGCTTCCGG + Intergenic
1078007304 11:7541567-7541589 GCTGCATGGTGGAGTGTTTCAGG + Intronic
1078729246 11:13961123-13961145 GATCCATGTCTGAGTGCTGAGGG - Intergenic
1079688405 11:23391734-23391756 CACCCATGGCTGAGTACTTCTGG + Intergenic
1086865163 11:91971611-91971633 GAACCATGGTTCAGTGGTTAAGG - Intergenic
1090646511 11:128770819-128770841 GATCCATGCCTAATTGCTTCTGG + Intronic
1094412650 12:30183235-30183257 GAAGCCTGGATGAGTGCTTCTGG - Intergenic
1094553911 12:31479113-31479135 GATCCAAAGTTGATTGCCTCAGG + Intronic
1096453179 12:51762535-51762557 GATCCATGGCTATGAGCTTCAGG - Exonic
1106174338 13:27316716-27316738 GATCCATGGGTGAGAGTTACAGG + Intergenic
1108679987 13:52771819-52771841 GATCCATGGGTGTGTGTCTCAGG - Intergenic
1111514639 13:89313301-89313323 GATACAGGGTTGAGTCCATCCGG - Intergenic
1118916589 14:70112555-70112577 GAGCCAAGGTTGAGGGCTTCTGG + Intronic
1122414349 14:101541758-101541780 GCTCCATGATGGAGTGGTTCTGG + Intergenic
1131330142 15:91490489-91490511 CATCCATGGTTGTGTGCCCCAGG - Intergenic
1139264563 16:65626710-65626732 GCTCCATGGTGCAGTGCTTAGGG + Intergenic
1141954819 16:87363662-87363684 GCTACATGGTTAAGTGCTACGGG + Intronic
1143658425 17:8310855-8310877 GATTCAAGGGTGAGTGCTTGGGG + Intronic
1143946655 17:10598589-10598611 GACCCCAGGTTGAGAGCTTCTGG + Intergenic
1156096895 18:33544377-33544399 CTTCCATGATTGAGTACTTCTGG - Intergenic
1158556246 18:58477124-58477146 GCTCCATGGTTGAGCCCTTCTGG + Intergenic
1159780932 18:72659603-72659625 TATCCATCCTTGAGTGCTTTGGG - Intergenic
926257594 2:11220607-11220629 GCTCTATGTTTGAGTGCTACTGG + Intronic
930321555 2:49861018-49861040 GATCCATGGTACAGCCCTTCTGG + Intergenic
937820272 2:126302676-126302698 GGCCCATGTTTGAGAGCTTCAGG + Intergenic
941831630 2:169967348-169967370 GATGGTTGGTTGAGTGCTTCAGG + Intronic
943041030 2:182805337-182805359 GATCCATTGTTGATTGAATCTGG + Intergenic
1175497226 20:59423481-59423503 CATCCTAGGTTGAGTGCTACAGG - Intergenic
1177846948 21:26300633-26300655 GAAGCATGATTGAGGGCTTCAGG + Intergenic
1179769840 21:43606339-43606361 GATCCAAGGTTGAAAGCATCAGG + Intronic
1181081762 22:20420304-20420326 GACCCCTGGTTGTGTGCTCCTGG - Intergenic
951955577 3:28249683-28249705 CAGCCAGGGTTGAGAGCTTCTGG + Intronic
965815763 3:172635068-172635090 GACCCACCGTTGAGTGCTGCGGG - Intronic
967138509 3:186532816-186532838 GGACCCTGGTTGAGTGGTTCTGG - Intergenic
967867002 3:194198477-194198499 GCCCCATGGCTGAGTGCTGCTGG + Intergenic
979032974 4:115675896-115675918 GATTTATGGTTGAGTACTCCAGG - Intergenic
982209791 4:153025041-153025063 GCTCCATGGGTGGGTGCTCCAGG + Intergenic
983148637 4:164248126-164248148 GATACATGGAGGAGTACTTCAGG - Intronic
987343284 5:16957107-16957129 CATCCATGCTTGGGTGCTTATGG + Intergenic
988559745 5:32269784-32269806 GATCCATTGTTGAGGCCTTTAGG + Intronic
994851723 5:105063387-105063409 CATGCATGGTTGATTCCTTCTGG - Intergenic
997030500 5:130121903-130121925 GATTCATGGCTGAGTGATCCTGG + Intronic
998429650 5:142060024-142060046 GACCCATGCTTGAGTGCCCCGGG + Intergenic
1003639648 6:7865842-7865864 GATCCCTGGTGGGCTGCTTCTGG - Intronic
1010503738 6:76631791-76631813 GAGGCCTGGGTGAGTGCTTCTGG + Intergenic
1011003265 6:82615397-82615419 GTTTCATGGTTGCTTGCTTCAGG + Intergenic
1015731402 6:136351958-136351980 GATTCATGGTAGAGTGCTTCTGG + Intronic
1016251333 6:142046906-142046928 GATCCATTGTTAAGTGTATCTGG + Intergenic
1016581132 6:145630249-145630271 GTGCAATGGTTGAGTGATTCCGG - Intronic
1017589517 6:155963481-155963503 GGTTGATAGTTGAGTGCTTCAGG + Intergenic
1021098562 7:16562091-16562113 GACGCATGGCTGAGAGCTTCAGG + Intronic
1023777309 7:43620140-43620162 GATCCATGGTTGAGTGCTTCTGG + Intronic
1028930712 7:96409764-96409786 GAAGCATGGTTGAGAGCTTTTGG + Intergenic
1030890859 7:114997262-114997284 GGTACATGGTTGAGTGCTATTGG + Intronic
1034380929 7:150691735-150691757 GATCCAGGACTGAGTGATTCAGG + Intronic
1041258421 8:55999447-55999469 CATCCAAAGTTGATTGCTTCTGG - Exonic
1042517805 8:69677967-69677989 GACCCATGGGTGAGCTCTTCTGG + Intronic
1049140303 8:140948702-140948724 GATCCATGGTTGGTTGAATCTGG - Intronic
1050779740 9:9317736-9317758 GATCCATGGCTTTGTGCTTCAGG - Intronic
1051574381 9:18598324-18598346 GACCCAGGTTTGAGTGTTTCTGG - Intronic
1053115873 9:35501692-35501714 GAACCATGGTTGGCTGCTACTGG - Intronic
1053901883 9:42803791-42803813 GATCCATGTTGGAATGCTTCAGG + Intergenic
1187136556 X:16552746-16552768 GTTCCATTGTTGAGTAATTCTGG + Intergenic
1187413323 X:19070061-19070083 GAGGCCAGGTTGAGTGCTTCTGG - Intronic