ID: 1023778595

View in Genome Browser
Species Human (GRCh38)
Location 7:43634628-43634650
Sequence TGGGGAGGCCTCATTACAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 99}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023778585_1023778595 23 Left 1023778585 7:43634582-43634604 CCCAAGCTCTCTGCTGGGCTAGC 0: 1
1: 0
2: 1
3: 21
4: 198
Right 1023778595 7:43634628-43634650 TGGGGAGGCCTCATTACAACAGG 0: 1
1: 0
2: 2
3: 11
4: 99
1023778586_1023778595 22 Left 1023778586 7:43634583-43634605 CCAAGCTCTCTGCTGGGCTAGCT 0: 1
1: 0
2: 1
3: 26
4: 250
Right 1023778595 7:43634628-43634650 TGGGGAGGCCTCATTACAACAGG 0: 1
1: 0
2: 2
3: 11
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023778595 Original CRISPR TGGGGAGGCCTCATTACAAC AGG Intronic
902233556 1:15043607-15043629 TGGGGAGGCCCCATGACATGTGG - Intronic
903632939 1:24790635-24790657 GGAGGTGGCCTCATTACCACTGG + Intronic
906026422 1:42677920-42677942 TGGGGATGCCTCTTAACTACTGG + Intergenic
913199615 1:116485165-116485187 TGGGGAGGCCTCATAAAAACAGG - Intergenic
915862553 1:159461634-159461656 TGGGGTGGTCTTATTACTACCGG + Intergenic
916126294 1:161574415-161574437 TGAGGAACCCTCATTACAATGGG - Intergenic
916136213 1:161656255-161656277 TGAGGAACCCTCATTACAATGGG - Intronic
921100877 1:211928592-211928614 TAGGCTGGGCTCATTACAACAGG + Intergenic
1062891434 10:1063678-1063700 GGGGGTGGCCTCATGACCACAGG - Intronic
1064196537 10:13248296-13248318 TGGGGAGGACTCAAAACCACGGG + Intergenic
1065749648 10:28874108-28874130 TGGGGAGGCCTCATAATCATGGG + Intronic
1067055883 10:43049617-43049639 TGGGGACTCCTCATTACAGCTGG - Intergenic
1067104095 10:43353744-43353766 TGGGGAGGCCAAATAACAAATGG + Intergenic
1068648178 10:59492753-59492775 TGCGGAGGCCTCACTGCTACAGG - Intergenic
1071765354 10:88658331-88658353 TGGGGAGGCCTAAATACAAAAGG + Intergenic
1081050318 11:38332027-38332049 TGGGGAGGCCTCAGGAAAACGGG - Intergenic
1085429730 11:76437566-76437588 GGGGGTGGCCTCATTACCACTGG - Intergenic
1087075750 11:94126074-94126096 AGGGAAGGATTCATTACAACTGG + Intergenic
1089805694 11:121086594-121086616 TAGGGAGGCCACAGTAAAACTGG - Intronic
1093974438 12:25405349-25405371 TGGGGTGGTCTCATTACTACTGG - Intergenic
1101756566 12:107625622-107625644 TGGGGTGGCCTCATGACTACTGG + Intronic
1102570538 12:113824641-113824663 TGGGGAGGTCTCAGTAGAAAAGG - Intronic
1105500404 13:20966669-20966691 TGGGGTGGCCTCATTGCCAGTGG - Intergenic
1118048904 14:62004859-62004881 GTGGGTGGCCTCATTACCACTGG + Intronic
1118381078 14:65217833-65217855 AGGGGAGGCCCCATTATAAGTGG - Intergenic
1121009653 14:90512512-90512534 TGGGGAGGCCTCCTTGCCCCAGG - Intergenic
1124705642 15:31961472-31961494 TGGGGAGGCCTCATGGCAGAAGG - Intergenic
1128614898 15:69101301-69101323 TGGGGAGGCCACAAGACACCTGG + Intergenic
1132245716 15:100294713-100294735 TGGGGAGCCCCTCTTACAACTGG - Intronic
1137279903 16:46967275-46967297 TAGGGAGACCTCATTACTATAGG - Intronic
1140464811 16:75172812-75172834 TGGGAAAGCCTCATTACAGTCGG - Intergenic
1140850881 16:78933655-78933677 TGGGGAGGCCTCACAATTACGGG + Intronic
1141822410 16:86455773-86455795 TGGGAAGGCCTCACTTCCACTGG + Intergenic
1142618380 17:1150061-1150083 TGGGGAGAAATCATAACAACAGG - Intronic
1145112113 17:20172850-20172872 TGGTGAGGCCTGATTATAAGTGG + Intronic
1146412244 17:32596428-32596450 AGGTGAGGCCTCATGACAAGAGG - Intronic
1150221224 17:63496950-63496972 TGGGCTGGCCGCAGTACAACTGG + Exonic
1152370237 17:79883285-79883307 TGGGGAGGCCTCATGGCTGCCGG + Intergenic
1203168966 17_GL000205v2_random:129368-129390 GGGTGAAGCTTCATTACAACTGG + Intergenic
1153595710 18:6723080-6723102 TGGGGAGGCCTCACAAACACTGG - Intergenic
1157616301 18:48989666-48989688 AGGGGAGGCCTTATTGGAACTGG + Intergenic
1158395137 18:57073376-57073398 TGGGCAGGCCTCATTTCTGCTGG - Intergenic
1161027685 19:2044195-2044217 TAGGGAGGCCTCAGGACACCTGG + Intronic
1161615982 19:5270431-5270453 TAGGCAGGCCCCATTACACCAGG + Intronic
1161976552 19:7610886-7610908 TGGGGAGGCCTCAGTGCCCCGGG - Exonic
1165182201 19:33981229-33981251 TGAGGTGGCCTCATTACTGCTGG - Intergenic
1168325833 19:55537823-55537845 TGGGGAGGCCTCAGTTCTGCCGG - Intergenic
1168698384 19:58419458-58419480 TGTGGATGCCTCTTTAGAACTGG - Intergenic
925250185 2:2427515-2427537 TGGGGAGGCCTCATGGCAGAAGG + Intergenic
933997284 2:87679267-87679289 TGGGGAGGCCTCTTCCCCACTGG - Intergenic
936272567 2:111060320-111060342 GGGGGTGGCCTCATTACTATTGG - Intronic
949061822 2:241964423-241964445 TGTGGAGGCCTCATTACGGAGGG - Intergenic
1170831959 20:19850554-19850576 TGGGGATGCCTGAATTCAACTGG + Intergenic
1172991502 20:39040329-39040351 TGGGGAGGCCCCTTTACAGTAGG + Intergenic
1174852520 20:54008428-54008450 AGTGGAGGTCTCATTACCACTGG - Intronic
1174904585 20:54537025-54537047 AGGAGTGGCCTCATTACCACTGG - Intronic
1180139738 21:45886203-45886225 TGTGGAGGCCTCATTGCTGCGGG + Intronic
1180139773 21:45886356-45886378 TGTGGAGGCCTCATTGCCGCGGG + Intronic
1180139785 21:45886405-45886427 TGTGGAGGCCTCATTGCTGCGGG + Intronic
1180193829 21:46182107-46182129 TGGGGAGGCCTCAGAGCCACCGG - Intronic
949587691 3:5458431-5458453 TGGGAAGGCATTATTACAAGAGG - Intergenic
950431873 3:12955510-12955532 TGGTGAGGTGTCACTACAACAGG + Intronic
950468931 3:13172837-13172859 TGGGGAGGCCCCTTCACATCTGG + Intergenic
950556662 3:13700120-13700142 TGGGGAGGCATCATTTTACCTGG + Intergenic
958777489 3:98503703-98503725 TGGGGAGGCCTCACAATCACGGG + Intronic
961649976 3:128412463-128412485 TGGGGAGGCCTCCTGCCAAGGGG + Intergenic
962045220 3:131751974-131751996 AGGGATGGCCTCATTACTACTGG + Intronic
968377197 4:53522-53544 TGGGGAGGCCTCATCGGAACCGG + Intronic
968384549 4:124704-124726 TGTGGAGGCCTCATCGGAACCGG + Exonic
968401909 4:305256-305278 TGGGGAGGCCTCATCCGAACCGG - Intronic
968419754 4:473928-473950 TGGGGAGGCCTCATCAGAACCGG - Intronic
970933061 4:21536117-21536139 TGGGGAGGCTTCATTGCGTCAGG + Intronic
971918284 4:32904181-32904203 TGGGGAGGCCTCACAACCATGGG + Intergenic
973061211 4:45727981-45728003 TGGGTAGGTCTCATTTCAACTGG - Intergenic
976689759 4:87856077-87856099 TGGGGGCTCCTCATTACTACAGG - Intergenic
990967891 5:61469681-61469703 GGGGGAGGCCTTATAAAAACTGG - Intronic
992176825 5:74157374-74157396 TGAGGTGGCCTCATAACCACAGG - Intergenic
992425009 5:76648056-76648078 GGGAAAGACCTCATTACAACTGG - Intronic
994956746 5:106542715-106542737 TGTGGAGGCCTTGTTAAAACAGG + Intergenic
996901222 5:128543558-128543580 TGGGATGGCCTCATTACTGCTGG - Intronic
1000225352 5:159255878-159255900 TGTGGGGGACTCATTACCACTGG - Intergenic
1001529623 5:172453327-172453349 GGGGAGGGCCTCATTACAGCAGG - Intronic
1001597377 5:172906890-172906912 TGGGGATGCCTCAAGACACCTGG + Intronic
1004576406 6:16899805-16899827 TGGGGAGGCCTCATGGCAGAAGG - Intergenic
1006419548 6:33924693-33924715 TGGGGAGGACTCATTAGTGCAGG + Intergenic
1006837360 6:37007067-37007089 TGGGGAGGCCTCATTCCTGAAGG + Intronic
1009534141 6:64859690-64859712 TGGGGAGGCCTCACAATCACAGG - Intronic
1015802922 6:137078687-137078709 TGGGGGGTCCTTATTGCAACTGG + Intergenic
1019569398 7:1703711-1703733 TGTGGAGCCCTAATTACCACGGG + Intronic
1022068390 7:26885270-26885292 TGGGGAGGCCTCATGGCAGGAGG + Intronic
1023778595 7:43634628-43634650 TGGGGAGGCCTCATTACAACAGG + Intronic
1026666097 7:72340929-72340951 TGGGGAGGCCTCACAATCACGGG - Intronic
1028175885 7:87657728-87657750 TGGGGTGGCCTCCTTACCACTGG - Intronic
1029906747 7:104100543-104100565 TGGGGAGGCTTCACTGCAGCTGG - Intergenic
1030987163 7:116255192-116255214 TGCAGAGAGCTCATTACAACAGG + Intronic
1032698335 7:134357021-134357043 TGGGGAGACACCATTACCACTGG - Intergenic
1036921952 8:12864691-12864713 TGGGTAGGCCTCATTCAATCAGG - Intergenic
1040565648 8:48564613-48564635 AGGGGAGGTCTCCTTACCACTGG - Intergenic
1042150952 8:65783369-65783391 GGGGGAGGCCACAGTACAAGAGG - Intronic
1050712075 9:8476348-8476370 TGGGGAGGGAGCATTACCACTGG - Intronic
1055183500 9:73420094-73420116 AAGAGTGGCCTCATTACAACTGG - Intergenic
1057150927 9:92795051-92795073 TGACCAGGCATCATTACAACTGG - Intergenic
1058864075 9:109145383-109145405 TGTGGAGGCTTCATTATAAAAGG - Intronic
1058996408 9:110302919-110302941 TAGGCAGGCGTCATCACAACTGG - Intergenic
1203437169 Un_GL000195v1:149325-149347 GGGTGAAGCTTCATTACAACTGG - Intergenic
1203572039 Un_KI270744v1:140724-140746 TGGGGAGGCCTCATCGGAACCGG - Intergenic
1187683489 X:21792547-21792569 GCGGGAGGCCTCATGACCACTGG - Intergenic
1192170898 X:68854115-68854137 TGGGGAGGGGTCATTCCAAGTGG - Intergenic
1192380485 X:70611478-70611500 TGTGGAGGCCTCCTTATGACTGG - Intronic
1193232341 X:79062633-79062655 TGGGGAGGCCTCATGGCAGGAGG - Intergenic
1195713726 X:107797460-107797482 TGGGGAGGCAAAATCACAACTGG + Intergenic
1198700708 X:139395418-139395440 TAGAGAGGCCTCTTTACAAATGG - Intergenic
1200918143 Y:8589568-8589590 TGTGGAGGCCACATCCCAACCGG - Intergenic