ID: 1023786251

View in Genome Browser
Species Human (GRCh38)
Location 7:43711107-43711129
Sequence CAGTGACAGCAGAAATCTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 254}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023786247_1023786251 6 Left 1023786247 7:43711078-43711100 CCCATCCCACATTTTTTACAATT 0: 1
1: 0
2: 2
3: 33
4: 497
Right 1023786251 7:43711107-43711129 CAGTGACAGCAGAAATCTTGTGG 0: 1
1: 0
2: 2
3: 18
4: 254
1023786249_1023786251 1 Left 1023786249 7:43711083-43711105 CCCACATTTTTTACAATTTCAGT 0: 1
1: 0
2: 3
3: 51
4: 534
Right 1023786251 7:43711107-43711129 CAGTGACAGCAGAAATCTTGTGG 0: 1
1: 0
2: 2
3: 18
4: 254
1023786248_1023786251 5 Left 1023786248 7:43711079-43711101 CCATCCCACATTTTTTACAATTT 0: 1
1: 0
2: 3
3: 56
4: 672
Right 1023786251 7:43711107-43711129 CAGTGACAGCAGAAATCTTGTGG 0: 1
1: 0
2: 2
3: 18
4: 254
1023786250_1023786251 0 Left 1023786250 7:43711084-43711106 CCACATTTTTTACAATTTCAGTG 0: 1
1: 0
2: 3
3: 49
4: 492
Right 1023786251 7:43711107-43711129 CAGTGACAGCAGAAATCTTGTGG 0: 1
1: 0
2: 2
3: 18
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023786251 Original CRISPR CAGTGACAGCAGAAATCTTG TGG Intronic
900586593 1:3435417-3435439 CAGGGACAGCAGGATTCATGGGG - Exonic
903864202 1:26386364-26386386 CAGTGTCAGCAGAAGTCTTAGGG + Intergenic
904281578 1:29424212-29424234 CAGTGACACCAGGAATCCAGAGG - Intergenic
907596373 1:55723906-55723928 CAATCACAACAGAAATCTGGTGG + Intergenic
907803958 1:57799891-57799913 TAGTGACAACAGAAACCATGGGG + Intronic
907810092 1:57860708-57860730 CAATAACAGCATAAATATTGTGG + Intronic
909372711 1:74903032-74903054 AAGTGACAGGAGAAAACTTTTGG + Intergenic
909622103 1:77680479-77680501 CAGTGCAAGTAGAAATGTTGAGG - Intronic
910792154 1:91063037-91063059 AAGTGAAGGCAGAAATCCTGAGG + Intergenic
910905201 1:92169038-92169060 TTGTGACAGCAGATATTTTGAGG + Intronic
911466323 1:98258022-98258044 GAATGACAGCAGATTTCTTGTGG - Intergenic
912663547 1:111557826-111557848 CAGTGACAGCATAAAAATTGGGG + Intronic
913182633 1:116336923-116336945 CAGTGACAGCAGCAGTGGTGGGG + Intergenic
915704746 1:157833239-157833261 CAGTGCCAGCACAGATTTTGGGG - Exonic
917008681 1:170446095-170446117 TAGAGACAGAAGAAATCTTGTGG - Intergenic
918117083 1:181507073-181507095 CATTCACAGCAGCAATCTTCTGG - Intronic
919940849 1:202284984-202285006 TAGTGAGAACAGAAATCTTCTGG + Intronic
920272886 1:204780051-204780073 CAGGGCCAGGAGAAATCTTATGG - Intergenic
920500232 1:206480866-206480888 AAGTGCCAGCAGAACTCTAGGGG + Intronic
922316833 1:224449852-224449874 CAGTCACACCAGACCTCTTGGGG + Intronic
923562635 1:235053113-235053135 CAATGACAGCAAAAATACTGAGG - Intergenic
1063870901 10:10416702-10416724 CAGAGACAACAGAAATGTTCTGG + Intergenic
1065999029 10:31087146-31087168 CTGTGACAGTAAAAATCCTGTGG + Intergenic
1067266516 10:44750077-44750099 CAGAGAAAGCAGAAAAATTGGGG - Intergenic
1067606307 10:47666498-47666520 CATTGACAGCAGAAATCCTTGGG - Intergenic
1068264959 10:54634849-54634871 CAGTGACAGCAGATATTATAAGG - Intronic
1068431668 10:56941161-56941183 CAGTGCCAGGAGAAAGCTTTAGG + Intergenic
1068610421 10:59053935-59053957 TAGAGACAGCACAAATCTTAAGG + Intergenic
1068765256 10:60756303-60756325 AAGTGATAGCTGTAATCTTGGGG + Intergenic
1068933916 10:62617836-62617858 CAGTGACAGCTGACAGCTTGTGG + Intronic
1071621866 10:87127851-87127873 CACTGACGGCAGAAATCCTTGGG - Intronic
1071664223 10:87538189-87538211 CAGTGCCAGCTGAAAATTTGAGG + Intronic
1073157784 10:101361631-101361653 CAAGTACAGCAGAAATATTGTGG - Intronic
1074034658 10:109726101-109726123 CAGTGAGAGCAGAAGCTTTGAGG - Intergenic
1074524876 10:114254507-114254529 CAGTAACAGCAGCAATGTGGAGG - Intronic
1074538909 10:114348776-114348798 GAATGACAGCAGAATTCTGGGGG - Intronic
1077407685 11:2389897-2389919 CAGCGACCTCAGAACTCTTGGGG + Intronic
1077659793 11:4057388-4057410 TAGTGACAGCAGGAAGCATGGGG + Intronic
1077840629 11:5971070-5971092 CAGTGACAGCACAAAGCTCTTGG + Intergenic
1079538563 11:21544468-21544490 CAGTCATAACAGAATTCTTGGGG + Intronic
1080287753 11:30635916-30635938 CAGTGAAAACAGAAGTCTTCGGG - Intergenic
1083627820 11:64080809-64080831 CAGTGATGGGAGAACTCTTGGGG + Intronic
1083737879 11:64691990-64692012 CAGTGACAGCAGAGGGCTAGAGG + Intronic
1085016677 11:73178415-73178437 CTGTGACAGCAGAAAGCCCGGGG + Intergenic
1086310606 11:85532288-85532310 CAAGGACAGCAGAAAACTAGAGG + Intronic
1089086792 11:115826626-115826648 CAGAGACAACAGAGATCTAGTGG + Intergenic
1089252329 11:117173929-117173951 CAGTGAAAACAGAAAGCTTCAGG + Intronic
1090780960 11:130006022-130006044 CAGTGATACAAGAAAACTTGGGG + Intergenic
1093768045 12:22987419-22987441 CAGTTAAAGCAGAAATCTTTGGG - Intergenic
1097540628 12:60937658-60937680 CACTGGCAGTGGAAATCTTGGGG - Intergenic
1097628468 12:62030608-62030630 CAGTGAAAGCAGCAACCTTAGGG + Intronic
1098620596 12:72593186-72593208 TAGTGACAGCAAAAAACATGTGG - Intronic
1098975109 12:76894571-76894593 GATTGACAGCAGAATTCTTGTGG + Intergenic
1099007892 12:77256703-77256725 GAGGAACAGCAGAAATCTTCAGG + Intergenic
1099490915 12:83286853-83286875 TAGTGAGAGTAGAGATCTTGGGG + Intergenic
1100685159 12:96979651-96979673 CATTCCCAGCAAAAATCTTGTGG + Intergenic
1100942495 12:99739708-99739730 AAGTGGCAGCAGAACGCTTGAGG - Intronic
1101651803 12:106684058-106684080 CAATGACAGAAGAAATCTGGGGG + Intronic
1102021489 12:109686588-109686610 CAGTGACAGCTGGCTTCTTGGGG - Intergenic
1102069204 12:110003463-110003485 CAGTGGAAACAGGAATCTTGAGG - Intronic
1102731030 12:115109905-115109927 CAGTGATAGCATACATCTTATGG + Intergenic
1103701968 12:122852971-122852993 CAGTGACAGGAGAGAGCCTGGGG - Intronic
1104597797 12:130131862-130131884 CCCTGGCAGCAGAAATCTGGAGG + Intergenic
1108119377 13:47166814-47166836 CGGTGCAAGCAAAAATCTTGCGG - Intergenic
1109928432 13:69180084-69180106 CAGGAAAAGCAGAAATCGTGGGG - Intergenic
1111428863 13:88126087-88126109 CAGATAAAGCAGAAATTTTGAGG - Intergenic
1113793658 13:113044181-113044203 CAATAACAGCAGAAACCTTCTGG - Intronic
1116523796 14:45880406-45880428 CAGGGACAGCTGAACTCCTGGGG + Intergenic
1116866024 14:50032337-50032359 CAGAGAGAGCAGGGATCTTGAGG + Intergenic
1117707998 14:58493140-58493162 CAGTTACAGCAGAAATAGAGAGG + Intronic
1117714809 14:58569722-58569744 CATGCACAGCATAAATCTTGGGG - Intergenic
1120815904 14:88857918-88857940 CAGCCACAGCAGAAATGATGGGG + Intronic
1120905183 14:89614236-89614258 CAGTGATAGAACAGATCTTGAGG + Intronic
1202838379 14_GL000009v2_random:96058-96080 TAGTGACAGCAGCAGTCTTCAGG - Intergenic
1202907746 14_GL000194v1_random:86123-86145 TAGTGACAGCAGCAGTCTTCAGG - Intergenic
1202885473 14_KI270722v1_random:103016-103038 TAATGACAGCAGAAGTCTTCAGG + Intergenic
1123496869 15:20834955-20834977 CAGGGACAGAAGAGATCCTGTGG - Intergenic
1123554101 15:21408547-21408569 CAGGGACAGAAGAGATCCTGTGG - Intergenic
1123590348 15:21845912-21845934 CAGGGACAGAAGAGATCCTGTGG - Intergenic
1125218999 15:37311509-37311531 AAGTGACACCAGAAAACTGGGGG - Intergenic
1127352717 15:58169041-58169063 CAGTGACTGCAGAAATCCCCAGG - Intronic
1127617531 15:60701780-60701802 CAGTGACCTCAGAAGTCTGGAGG + Intronic
1129929656 15:79399816-79399838 CAGTGACAGCTGAAATCAGGGGG + Intronic
1130028348 15:80289480-80289502 CTGTGACAGCAGAAATGAGGAGG + Intergenic
1131618442 15:94041653-94041675 CAGAAAGAGCAGAAATATTGAGG + Intergenic
1131924591 15:97368398-97368420 CAGTGAGAGCCGAAGTCTTCGGG + Intergenic
1131961634 15:97795534-97795556 CTGTGACTGCCGAAATCTTCTGG + Intergenic
1202962449 15_KI270727v1_random:135743-135765 CAGGGACAGAAGAGATCCTGTGG - Intergenic
1133753776 16:8745948-8745970 TGGTGACAGCAGAGATCATGAGG - Intronic
1133968878 16:10552767-10552789 CAGTGTCAGTAGAAATCCTCAGG + Intronic
1135480557 16:22817532-22817554 CATTAACTGCAGAAATCATGGGG + Intronic
1138033823 16:53582209-53582231 CAGAAACAGAAGAAATCTTTAGG + Intergenic
1138560249 16:57797105-57797127 CACTGACAGCACAAATGTGGTGG + Intronic
1139244820 16:65431436-65431458 CAGTGACAGCAGCTATGGTGGGG - Intergenic
1140461745 16:75145689-75145711 CAGGGACAGCAGAACTCCAGGGG + Intergenic
1141980375 16:87546562-87546584 CAGTGGCAGCAGAAATGGTCCGG - Intergenic
1142748005 17:1969995-1970017 GAGAGAGAGCAGAAATCCTGAGG - Intronic
1142965407 17:3577748-3577770 CAGTGACTGCAGAAAGCTGCGGG + Exonic
1143995034 17:10998866-10998888 CAGAGAAACCAGAAATCTAGAGG + Intergenic
1146297274 17:31659719-31659741 TAGTGACAGAAGGAATTTTGAGG - Intergenic
1150718934 17:67597916-67597938 CAGTGACAGTAGAAATAGAGAGG + Intronic
1150893196 17:69178589-69178611 CAGGGACACCTCAAATCTTGGGG - Intronic
1150952393 17:69818235-69818257 CAGAAACATCAGAAATCCTGAGG + Intergenic
1155613755 18:27698430-27698452 CAGTCACATAAGAAAACTTGAGG - Intergenic
1156952764 18:42923263-42923285 CAGAAACTGCAGAAATCTTAAGG + Intronic
1157259182 18:46164038-46164060 GACAGACAGCAGTAATCTTGAGG + Intergenic
1158228715 18:55229517-55229539 CCGTGACATCTGAAATCTAGGGG + Intronic
1158444570 18:57508274-57508296 CAGAGTCAGGAAAAATCTTGGGG - Intergenic
1158745256 18:60192488-60192510 CAGTGTCAGTAGAAATTTTAGGG - Intergenic
1159731494 18:72033583-72033605 CAGAGAGTGCAGCAATCTTGAGG - Intergenic
1160083097 18:75749007-75749029 CAGTAACAGCACAAATATGGTGG - Intergenic
1163648678 19:18504643-18504665 AAGTCACAGCAGAAAACCTGAGG + Intronic
1167840215 19:52110655-52110677 GAGTGAGAGAAGAAATGTTGTGG - Intergenic
1202660876 1_KI270708v1_random:70042-70064 TAATGACAGCAGAAGTCTTCAGG + Intergenic
927480311 2:23448587-23448609 CTGTGGAAGCAGCAATCTTGAGG - Intronic
927941538 2:27106267-27106289 CAGTGAAAACAGTAATCTGGGGG + Intronic
929537229 2:42791445-42791467 CAGTGATAGAAGAGATCTTTGGG + Intronic
930147751 2:48024812-48024834 CAATGACAGAAAAAATCCTGAGG + Intergenic
931008499 2:57880268-57880290 CAGTTACATTAGAATTCTTGGGG - Intergenic
932414997 2:71568231-71568253 CCGTGACGTCAGAAAACTTGGGG - Exonic
933537895 2:83599991-83600013 CAGTAACAGGAGGAATCTTGAGG + Intergenic
936344704 2:111666459-111666481 CAGTGATGGCAGGGATCTTGGGG + Intergenic
936680815 2:114769084-114769106 CATTGACAGCATAAATCTAGAGG + Intronic
936750646 2:115637524-115637546 CAGTGACAGAATAAAGATTGAGG + Intronic
937253256 2:120537279-120537301 CAGAGACAGGAGAAATGTTGGGG + Intergenic
937814863 2:126240003-126240025 CAGTTTAATCAGAAATCTTGAGG + Intergenic
943117401 2:183691137-183691159 CAGTGACAGAAGCATTCCTGTGG + Intergenic
943897072 2:193377991-193378013 CAGTGTCAGTAGAAATCATGTGG - Intergenic
943920667 2:193703395-193703417 CAGTGACAGAAGAAAACTTGAGG + Intergenic
945939343 2:215932618-215932640 CAGTGCCAGCAAAAATCTGAAGG + Intergenic
948248845 2:236508615-236508637 CAGGGACAGGAGAAATCTCCAGG + Intergenic
1169390452 20:5186353-5186375 CACTGACTTCAGAGATCTTGAGG + Intronic
1173312147 20:41906195-41906217 CAGGGAAAGCGGAAATCATGTGG - Intergenic
1173338024 20:42128834-42128856 CAGAGAGAGCAGAAATCAAGGGG + Intronic
1174547616 20:51337547-51337569 GAGTTCCAGCAGAAATCCTGAGG + Intergenic
1175787743 20:61722785-61722807 CAAGGAAAGCAGAAATTTTGTGG + Intronic
1175937364 20:62519923-62519945 GAGAGTCAGCAGAATTCTTGTGG - Intergenic
1176308104 21:5134921-5134943 CAGGGACAACAGCCATCTTGTGG + Intronic
1176600909 21:8794117-8794139 TAGTGACAGCAGCAGTCTTCAGG + Intergenic
1176627050 21:9100508-9100530 TAGTGACAGCAGCAGTCTTCAGG - Intergenic
1177425180 21:20914002-20914024 AAGTGACAGAAGAAATCATGAGG + Intergenic
1177918070 21:27115607-27115629 CAGTAACAGCAGGACTCTGGGGG + Intergenic
1178417784 21:32417847-32417869 CAATTACATCAGAAGTCTTGGGG - Intronic
1179302149 21:40122066-40122088 AAGAGACAGGAGAAATCCTGGGG + Intronic
1179848956 21:44127111-44127133 CAGGGACAACAGCCATCTTGTGG - Intronic
1180328362 22:11453638-11453660 TAATGACAGCAGAAGTCTTCAGG + Intergenic
1180343196 22:11685654-11685676 TAGTGACAGCAGCAGTCTTCAGG + Intergenic
1180417446 22:12780420-12780442 TAGTGACAGCAGCAGTCTTCAGG - Intergenic
1181165570 22:20981216-20981238 CAGTGGCAGCAGAGGCCTTGAGG - Exonic
1184926324 22:47642291-47642313 CAGTGCCAGCAGAGACCATGTGG + Intergenic
949680051 3:6503149-6503171 CATTCACAGCTGAAATCTAGAGG - Intergenic
950616804 3:14166405-14166427 CAGCTACTGCAGAAATCTAGAGG - Intronic
951168335 3:19508193-19508215 CAGTGAAAACAGAAAACTTCAGG - Intronic
951359886 3:21712822-21712844 CAGTAAAGGCAGAAAGCTTGTGG - Intronic
952706369 3:36381366-36381388 CAGTGACAGGAGAACTGCTGCGG - Intronic
955034792 3:55256987-55257009 CAGAGAAAGCAGAAATCCTATGG + Intergenic
955136455 3:56223579-56223601 AAGTGTCAGCAGAAATAGTGTGG - Intronic
957880198 3:86201944-86201966 CAATGACAGCAGTAGTGTTGTGG - Intergenic
960245900 3:115400145-115400167 CAGGGACAGCAAAAACCCTGAGG + Intergenic
961583570 3:127903292-127903314 CAGTCACATCAGAAATCCAGAGG + Intergenic
963344454 3:144077952-144077974 CAGTGACAGTTAATATCTTGAGG - Intergenic
964061176 3:152525741-152525763 CAGTGAAAGAGGAAATTTTGAGG + Intergenic
964574770 3:158153440-158153462 TAGTTACAGCAGAAACATTGTGG - Intronic
965722862 3:171680714-171680736 CACAGACAGCAGAAATCTCAAGG - Intronic
967556645 3:190866355-190866377 AAGTGAAAGCAGAAATGCTGTGG - Intronic
967696048 3:192531761-192531783 CAGTGACAGCATCAAGCGTGTGG - Intronic
968351718 3:198061794-198061816 CTGTAACAGCAGAAATACTGTGG + Intergenic
968655230 4:1775673-1775695 CAGTGAGGGCAGGAAGCTTGGGG - Intergenic
970951381 4:21759915-21759937 CATTGAGAGCAGAAATCTAAAGG - Intronic
971505055 4:27357777-27357799 AAGACACAGCAGAGATCTTGAGG + Intergenic
973077271 4:45945118-45945140 CAAGGACAGAAGAAGTCTTGTGG + Intergenic
973364349 4:49196866-49196888 TAGTGACAGCAGCAGTCTTCAGG + Intergenic
973396737 4:49599872-49599894 TAGTGACAGCAGCAGTCTTCAGG - Intergenic
974977456 4:68907508-68907530 TAGATAAAGCAGAAATCTTGAGG + Intergenic
975365792 4:73526081-73526103 CAATGAGTACAGAAATCTTGTGG - Intergenic
976595724 4:86892992-86893014 CAGTGACATGCGAAATCTTAAGG - Intronic
976672212 4:87666110-87666132 CCCTGACAGCAGAAAGTTTGGGG - Intergenic
977131768 4:93248520-93248542 CAGAGAAAGCAGAAAATTTGAGG - Intronic
977960905 4:103084420-103084442 CAATCACAGAAGAAAACTTGAGG - Intronic
978580611 4:110228069-110228091 CACTCAGAGCAGAAACCTTGGGG - Intergenic
981309019 4:143277889-143277911 CAGTGTCAGCAGACACATTGGGG - Intergenic
981495371 4:145385769-145385791 CAGTGTCAGCAGAGACCATGTGG - Intergenic
982330948 4:154181688-154181710 CAATTACAGCAGAATCCTTGAGG + Intergenic
984765588 4:183398301-183398323 CCGGCACAGCAGAAACCTTGGGG + Intergenic
986056996 5:4147907-4147929 TAATGACAACAGAAAACTTGTGG + Intergenic
986955161 5:13141494-13141516 CAATGACAGCAGAAAATTTCAGG + Intergenic
987417548 5:17679790-17679812 CACTGACAGCATCATTCTTGTGG + Intergenic
989768456 5:45114408-45114430 CACTGAAACCACAAATCTTGGGG - Intergenic
990658730 5:57988111-57988133 CAATGACAGCACAAAATTTGAGG - Intergenic
990881496 5:60543998-60544020 AAGTAAAATCAGAAATCTTGAGG - Intergenic
991507225 5:67337930-67337952 CAGTGACAGCTGTTGTCTTGAGG - Intergenic
992035874 5:72775548-72775570 CAGTGACATCAGCAAGATTGTGG + Intergenic
993418687 5:87671765-87671787 TAGTGACAACAGAAATATGGTGG - Intergenic
994536386 5:101035468-101035490 TTGTTACAGCAGAAATTTTGGGG - Intergenic
994998937 5:107102677-107102699 CAGTTCCAGCAGAAGTATTGGGG - Intergenic
995420195 5:111956188-111956210 CAGAGACAGGAGAATTCTTCAGG + Intronic
996028815 5:118682538-118682560 CATTGACAGAAGAAATGTTTAGG - Intergenic
996684326 5:126263885-126263907 CAGCAGCAGCAGAAATCTTGAGG + Intergenic
996860019 5:128054771-128054793 AAGTGACAGTTGAAACCTTGAGG - Intergenic
997454870 5:134009004-134009026 GAGTGACAGCAGTAATCTCTTGG + Intergenic
997574789 5:134966352-134966374 CAGGGACAGCAGAGATGGTGGGG + Exonic
997933530 5:138091188-138091210 CACTGATAGCAGATATCATGAGG - Exonic
998728054 5:145041734-145041756 CTGTGACAGCAGAGACCTTGTGG - Intergenic
998929729 5:147167945-147167967 CAGTGACAGCAACCATTTTGTGG - Intergenic
998987710 5:147780392-147780414 CAATGAAAGCAGATATCCTGGGG - Intronic
998995038 5:147862270-147862292 CAATGAAGGCAGACATCTTGCGG - Intergenic
999311731 5:150555827-150555849 CTGTGACAGCAGAGATCTTCTGG + Exonic
1006832052 6:36974626-36974648 CAGTGTCCGGAGACATCTTGTGG - Intronic
1007132731 6:39491687-39491709 CAGTGTTAGCAGAAGCCTTGAGG + Intronic
1007735133 6:43977627-43977649 CAGTGACATGAGATATCTTTGGG - Intergenic
1009480771 6:64155894-64155916 AAATGACAGCAGAAAACATGTGG + Intronic
1009532274 6:64833474-64833496 TAGTCACAGAAGAAATGTTGGGG - Intronic
1010104212 6:72148666-72148688 TAGTGACAGCACAAGTCTAGGGG - Intronic
1011743069 6:90382536-90382558 CAGTGACAGCTGAGATGTAGTGG - Intergenic
1012210561 6:96513167-96513189 CAGTGGCATCAGAAATCTAAGGG - Intergenic
1012313910 6:97761522-97761544 AAGTCACAGAAGAAATATTGAGG + Intergenic
1012709544 6:102581937-102581959 CAGGGACAGCCTGAATCTTGAGG + Intergenic
1013102285 6:106996975-106996997 CAATGACAGAGGAAAGCTTGGGG - Intergenic
1013846833 6:114463409-114463431 CAGGGACAACAGAAATTCTGAGG + Intergenic
1014881148 6:126726008-126726030 AAATTAGAGCAGAAATCTTGGGG + Intergenic
1015525747 6:134174711-134174733 CGGTGAGTGCAGGAATCTTGCGG - Intronic
1015887619 6:137934495-137934517 CAACCACAGCAGAAATGTTGGGG + Intergenic
1018727575 6:166626054-166626076 CAGTGTCAGGCGAAATCTTTGGG + Intronic
1019343784 7:520120-520142 CAGTGCCAGCTGCAATCCTGCGG + Intronic
1020015488 7:4829135-4829157 CAGTGGCACCTGACATCTTGTGG - Intronic
1020891316 7:13881212-13881234 CAAAGACAACAGAAATCTGGAGG - Intergenic
1020950462 7:14669546-14669568 CAGAGAAAGAAGAAATGTTGGGG - Intronic
1021270046 7:18574498-18574520 CAGGGACAGCCAAAATCCTGGGG - Intronic
1022294969 7:29042275-29042297 AAGTGACAGTAGTAATGTTGGGG - Intronic
1023085203 7:36563282-36563304 CAGTGACAGCAGAAATAGTGGGG - Intronic
1023105460 7:36759513-36759535 AAAGGACAGCAGAAATCTTAGGG - Intergenic
1023786251 7:43711107-43711129 CAGTGACAGCAGAAATCTTGTGG + Intronic
1024543892 7:50501144-50501166 CACTGACAGCAGGAAGCTGGAGG - Intronic
1025112274 7:56228521-56228543 AAGTGACATCAGAACTCTTCAGG - Intergenic
1027157010 7:75775599-75775621 CAGTGACAGCAGGGAACTGGGGG - Intronic
1027738901 7:81974845-81974867 CAATTAAAACAGAAATCTTGGGG + Intronic
1027741473 7:82012027-82012049 CTGTGATAGAAGAAATTTTGGGG + Intronic
1032639287 7:133748158-133748180 CAGTGAAAACAAAAATCTGGGGG - Intronic
1033354176 7:140586086-140586108 AAGTCCCAGCAGAAATCCTGAGG - Intronic
1034068640 7:148161240-148161262 CAATGACAGCAGAAAACTGTAGG - Intronic
1035538510 8:412356-412378 CAGAGACTGCAGAAATATTTAGG - Intronic
1036828261 8:11997102-11997124 TAGTGTCAGCAGAAAAGTTGTGG - Intergenic
1036931061 8:12955863-12955885 CAATGACAGCAGCAACCCTGGGG - Intronic
1039264773 8:35812716-35812738 CAGAGACAGTAGAAAACTTCAGG + Intergenic
1041296146 8:56359213-56359235 CAGTGACAAAACAAATCTGGTGG + Intergenic
1042028271 8:64446935-64446957 AAGTGACAGCAGAAAGCTGAGGG - Intergenic
1042225487 8:66511692-66511714 CAGTGACAGCAGGAGTCCAGAGG + Intronic
1044236544 8:89837696-89837718 CAATGAAAGCAGAAATGTGGTGG + Intergenic
1045857849 8:106784451-106784473 CAGTGAGTGAAGAAATCTGGTGG + Intergenic
1046286507 8:112099488-112099510 TACAGACAGCAGAAATCTTTGGG + Intergenic
1047113784 8:121818484-121818506 CAGGGACAGCCGAACTCTAGGGG + Intergenic
1047215244 8:122870797-122870819 CAGTCACAGCAGAAATGGAGTGG + Intronic
1047371591 8:124260488-124260510 CAATGACATCAGAAATTCTGGGG + Intergenic
1047398808 8:124528630-124528652 CAGTGTCTGCAGCTATCTTGAGG + Intronic
1050932009 9:11340855-11340877 CATTGAAACTAGAAATCTTGAGG - Intergenic
1052430510 9:28360561-28360583 CAGTGCCTTCAAAAATCTTGTGG - Intronic
1052799866 9:32957041-32957063 CAGTGAGAACAGAAGTCTTTGGG - Intergenic
1053048921 9:34942295-34942317 CAGTGCCAGCAGACTTCTTTGGG - Intergenic
1055536312 9:77248962-77248984 CAATGCCAGCAGATAACTTGAGG - Intronic
1055778387 9:79791475-79791497 CAGAGGCAGCAGAAATCAGGAGG - Intergenic
1056836746 9:89961668-89961690 CAGAGACAGAACAGATCTTGTGG + Intergenic
1057979777 9:99649595-99649617 CTGTGACATCAGGAAGCTTGAGG + Intergenic
1058351899 9:104035000-104035022 CAGTGAGAGCAGAAAACATGGGG - Intergenic
1060376862 9:123123123-123123145 AAGTCAGAGAAGAAATCTTGAGG + Exonic
1060559701 9:124532959-124532981 CAGTAACAGCAGAAGTAGTGAGG - Intronic
1203749942 Un_GL000218v1:68495-68517 TAGTGACAGCAGCAGTCTTCAGG - Intergenic
1186097805 X:6121193-6121215 CAATGGCAGAAGAAATCTTATGG + Intronic
1188626493 X:32291627-32291649 CAATGACACCACAAATCATGTGG - Intronic
1188861231 X:35259133-35259155 CACAGGCAGCAGAAATCATGGGG - Intergenic
1190233418 X:48599177-48599199 CAGGAACAGCAGAACTCGTGAGG + Intronic
1190418141 X:50201057-50201079 CAGTGACAGCACAAAGATGGAGG + Intergenic
1195541412 X:106067609-106067631 CAGTGGCAGCAGAAGTGTGGTGG + Intergenic
1200933411 Y:8717277-8717299 CAGTGACAGCTGAAGGCTTTAGG + Intergenic
1201163596 Y:11186137-11186159 TAGTGACAGCAGCAGTCTTCAGG - Intergenic
1201552309 Y:15230508-15230530 CAATGACAGCATACATTTTGGGG - Intergenic