ID: 1023788141

View in Genome Browser
Species Human (GRCh38)
Location 7:43728979-43729001
Sequence TTTCTGTTATTCAAGTGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 242}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023788137_1023788141 -6 Left 1023788137 7:43728962-43728984 CCCCTGTTGGGAGGGTTTTTCTG 0: 1
1: 0
2: 0
3: 18
4: 172
Right 1023788141 7:43728979-43729001 TTTCTGTTATTCAAGTGTGGTGG 0: 1
1: 0
2: 1
3: 18
4: 242
1023788138_1023788141 -7 Left 1023788138 7:43728963-43728985 CCCTGTTGGGAGGGTTTTTCTGT 0: 1
1: 0
2: 1
3: 14
4: 221
Right 1023788141 7:43728979-43729001 TTTCTGTTATTCAAGTGTGGTGG 0: 1
1: 0
2: 1
3: 18
4: 242
1023788130_1023788141 25 Left 1023788130 7:43728931-43728953 CCCCTACACAGAAAATCACTTTT 0: 1
1: 0
2: 2
3: 24
4: 337
Right 1023788141 7:43728979-43729001 TTTCTGTTATTCAAGTGTGGTGG 0: 1
1: 0
2: 1
3: 18
4: 242
1023788131_1023788141 24 Left 1023788131 7:43728932-43728954 CCCTACACAGAAAATCACTTTTG 0: 1
1: 0
2: 2
3: 23
4: 362
Right 1023788141 7:43728979-43729001 TTTCTGTTATTCAAGTGTGGTGG 0: 1
1: 0
2: 1
3: 18
4: 242
1023788139_1023788141 -8 Left 1023788139 7:43728964-43728986 CCTGTTGGGAGGGTTTTTCTGTT 0: 1
1: 0
2: 1
3: 21
4: 212
Right 1023788141 7:43728979-43729001 TTTCTGTTATTCAAGTGTGGTGG 0: 1
1: 0
2: 1
3: 18
4: 242
1023788132_1023788141 23 Left 1023788132 7:43728933-43728955 CCTACACAGAAAATCACTTTTGC 0: 1
1: 0
2: 0
3: 41
4: 381
Right 1023788141 7:43728979-43729001 TTTCTGTTATTCAAGTGTGGTGG 0: 1
1: 0
2: 1
3: 18
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023788141 Original CRISPR TTTCTGTTATTCAAGTGTGG TGG Intronic
900700340 1:4044502-4044524 TTACTGTTATGTAACTGTGGAGG - Intergenic
904916911 1:33976899-33976921 TTTAGGTTCTTCAAGTGTCGTGG + Intronic
906642234 1:47448406-47448428 TTTCGGATCTTCCAGTGTGGTGG + Intergenic
911631951 1:100193254-100193276 TTTCTATTCTTTAAGTGAGGAGG + Exonic
913440399 1:118890796-118890818 TTACTGTTTTTCAATTTTGGGGG - Intronic
915442366 1:155952975-155952997 TTTCTGTTGGTCAGGTGTAGTGG + Intronic
915922042 1:159983218-159983240 TTTCTTTTCTTCTACTGTGGAGG + Intergenic
916526381 1:165613456-165613478 TTTTAATTAGTCAAGTGTGGTGG + Intergenic
916831515 1:168496902-168496924 TCTGTGTTATTGAAGTTTGGCGG + Intergenic
917048412 1:170890074-170890096 TTTCTGTGATCAAGGTGTGGGGG + Intergenic
917066087 1:171095089-171095111 TTTCTTTTATTCATGTTTTGTGG + Intronic
917937639 1:179883599-179883621 TTGCTGTTTCTCCAGTGTGGTGG + Intronic
919423478 1:197401175-197401197 TTTCTGTTATTGTAGAGTGTGGG + Intronic
919671477 1:200342173-200342195 TTTCTGTTTTTAAAATATGGAGG - Intergenic
920360789 1:205414733-205414755 TTTCAGTTACCCAGGTGTGGTGG + Intronic
920536062 1:206737307-206737329 ATTCAGTTATTCAAGGGAGGAGG + Intergenic
921007416 1:211108318-211108340 TTTCTGTTTTTGGAGGGTGGGGG - Intronic
923474295 1:234318321-234318343 GTTCTGTAAATCAAGGGTGGAGG - Intronic
923694365 1:236232789-236232811 TTTGTTTGTTTCAAGTGTGGAGG - Intronic
923772576 1:236950486-236950508 CTTCTGTTATTCAAGAATGAAGG - Intergenic
923901930 1:238335593-238335615 TTTCTGTTTTTAAAAGGTGGAGG - Intergenic
923910785 1:238441309-238441331 ATTCTGTTATGCAATTGTGATGG - Intergenic
1062798961 10:365383-365405 TTTTAATTATTCAGGTGTGGTGG + Intronic
1064587783 10:16856037-16856059 TTTCTGTGTTTCAATGGTGGGGG + Intronic
1065134870 10:22657763-22657785 TTTCAGTTTTTCAAGTGGGCAGG - Intronic
1065914428 10:30341414-30341436 TTTATGCTTTTCAAGGGTGGAGG - Intronic
1066147542 10:32577073-32577095 GTTCTGTTGGCCAAGTGTGGTGG + Intronic
1066486224 10:35847693-35847715 TTTCTGTTGTTACTGTGTGGTGG - Intergenic
1067307201 10:45075256-45075278 TTTCTGTTATTATTGTGTGGTGG - Intergenic
1068359275 10:55954578-55954600 TGGCTGTGATTGAAGTGTGGGGG - Intergenic
1072177397 10:92941833-92941855 TTTTAGTAATTCAAGTGTGGGGG - Intronic
1072228556 10:93393156-93393178 ATTGAGTTATTCATGTGTGGTGG - Intronic
1072653870 10:97317364-97317386 TTTGTTTTTGTCAAGTGTGGAGG - Intergenic
1072850977 10:98891741-98891763 TAACTGTTATCCAGGTGTGGTGG - Intronic
1073211658 10:101808660-101808682 TTTCTGTTATTTTAGTTTGCTGG - Intronic
1074271070 10:111953988-111954010 TTTCACTTATTCAATAGTGGGGG - Intergenic
1081947490 11:47010520-47010542 TGTCTGTTTTTCAAGTCTGATGG + Intronic
1082207177 11:49451732-49451754 ATTTTCTTATTCAAGTGTGAAGG - Intergenic
1084640332 11:70422049-70422071 TTTCTGTGTTTCATTTGTGGTGG + Intronic
1085367907 11:75969441-75969463 TTTCTGTTTTTACAGTGGGGTGG + Intronic
1086118309 11:83278458-83278480 ATTGTGTTATTCATGAGTGGTGG - Intronic
1087231796 11:95674614-95674636 TTTCTGTTATTAAAGTACGTAGG - Intergenic
1090232895 11:125121730-125121752 TTTCAGTTTTTCAAGTGTCCAGG + Intergenic
1092493481 12:8968543-8968565 TTTCTGTTAATTACGTGGGGTGG - Intronic
1092569615 12:9708293-9708315 TTTCTGTTTTTTAAGTGAGAGGG + Intergenic
1092574689 12:9767671-9767693 TTTATTTTATTTTAGTGTGGGGG - Intergenic
1094772074 12:33674586-33674608 TTTCTCTTAGGCAAGTGTGCAGG + Intergenic
1096750041 12:53752686-53752708 TTTCTGATATTCAATTTTGGGGG - Intergenic
1097434885 12:59544298-59544320 TTTCTAATATTCCAGTGGGGAGG + Intergenic
1097445104 12:59661059-59661081 TCTCTGTTATTCCTATGTGGAGG + Intronic
1097933683 12:65220421-65220443 ATTTTGTTATTGAATTGTGGGGG + Intronic
1098672008 12:73242607-73242629 TTTCTGTTATACATGAGTGAGGG - Intergenic
1098984054 12:76991396-76991418 TTTCTGTTGTTCAAGTTAGAAGG - Intergenic
1099204695 12:79713790-79713812 TTTCTGTTATCTAATTGTGTTGG + Intergenic
1100862247 12:98818318-98818340 TTCCTGTTATTCATTTGTAGAGG + Intronic
1101957028 12:109221078-109221100 TTTCTATTATTAAACGGTGGTGG - Intronic
1102418280 12:112783373-112783395 TTTCTATTATGCATGTGAGGTGG - Intronic
1103383747 12:120515242-120515264 TTTAAGTTAGCCAAGTGTGGTGG - Intronic
1104281973 12:127386786-127386808 TTTCTGGGACTAAAGTGTGGGGG - Intergenic
1106511670 13:30418587-30418609 TTTCTGTCATTCAAGTCTCAGGG - Intergenic
1109791718 13:67257716-67257738 ATACTATTATTCAAGTGTGTTGG + Intergenic
1111928663 13:94490671-94490693 TTTCTATTATGAAAGTTTGGAGG - Intergenic
1112147151 13:96712490-96712512 TCTCTATTATTCCAGGGTGGGGG + Intronic
1112209494 13:97361709-97361731 TTTCTTTCATTCCAGTGTGGAGG - Intronic
1114447069 14:22796835-22796857 TTTCTGTTTTGCAAGAGAGGTGG - Intronic
1114748296 14:25174215-25174237 TTTCTTTTAGTGCAGTGTGGTGG + Intergenic
1115803847 14:37029000-37029022 TTTCTGTTATTCTGATGTGCTGG - Intronic
1116203702 14:41833463-41833485 TTTCTGTAACTCATGTGTAGTGG - Intronic
1116403832 14:44543453-44543475 TTTTTGTTATTCAAGGCAGGAGG + Intergenic
1116415061 14:44669236-44669258 TTGCTGTGATTCACGTATGGGGG - Intergenic
1117279410 14:54223231-54223253 TTTTTGTTATTCAAGTTTGCTGG - Intergenic
1118748085 14:68788718-68788740 TTTCTTTTTTTTAAGTGGGGAGG - Exonic
1121197556 14:92087599-92087621 TTTTTGTCATTCAAGTATGATGG + Intronic
1125431505 15:39599361-39599383 TTTCTGTTATTTAGGTAAGGGGG - Exonic
1129557912 15:76532526-76532548 TTTCTCTCATTCAAGTCTGCAGG + Intronic
1129622448 15:77160688-77160710 TTTTTTTCTTTCAAGTGTGGGGG - Intronic
1130332664 15:82934128-82934150 TTTCTGTTCTGCATATGTGGGGG - Intronic
1130944266 15:88539116-88539138 TTTCTCTTATTCAAGTTTCTTGG + Intronic
1131412199 15:92219098-92219120 TTTCTGTTCTTCAGCTGTGATGG - Intergenic
1131817503 15:96236284-96236306 TTTTAATTAGTCAAGTGTGGTGG + Intergenic
1131900391 15:97081782-97081804 TTGCTGTGATGAAAGTGTGGGGG - Intergenic
1132124896 15:99214576-99214598 TTTAATTTATCCAAGTGTGGTGG - Intronic
1132615282 16:838265-838287 TTTCTTTTATTAAGGTTTGGTGG + Intergenic
1132776489 16:1597792-1597814 TTTCTTTTATTCAAGAGATGGGG + Intronic
1134223407 16:12373283-12373305 TTTGAGTTAGCCAAGTGTGGTGG - Intronic
1134872208 16:17662176-17662198 TGCCAGTTATTCTAGTGTGGGGG + Intergenic
1135826309 16:25731626-25731648 TCTCTGTAGGTCAAGTGTGGTGG - Intronic
1138948390 16:61880340-61880362 TTTCTGTCTTTCGAGTGTGAAGG - Intronic
1139715921 16:68813062-68813084 TTTCAGTTAGCCAGGTGTGGTGG + Intronic
1140017386 16:71200666-71200688 TTTGTGTTCTTCAAGTGAGAAGG - Intronic
1140187480 16:72788001-72788023 TTTCTGTTCTTCTGGTTTGGGGG + Exonic
1141779122 16:86146289-86146311 TTTCTGTTATTGGAGAATGGTGG + Intergenic
1143063800 17:4226372-4226394 TTTTAATTAGTCAAGTGTGGTGG + Intronic
1143678697 17:8459050-8459072 TAGCTGTTATTGAAATGTGGGGG + Intronic
1145097079 17:20039562-20039584 TTTTTGTTTTTCAACTGAGGTGG + Intronic
1145743904 17:27298900-27298922 TTTCAGTTAGCCAAGTGTGGGGG + Intronic
1145851785 17:28106477-28106499 TATCTCTTATTCAAGTGTTCTGG - Intronic
1146197943 17:30829137-30829159 TTTCTGTTATTCAAATGCTGAGG - Intergenic
1146897345 17:36553755-36553777 TTTCAGGTATTAAAATGTGGGGG - Intronic
1148363940 17:47038460-47038482 TTTTAGTTATCCGAGTGTGGTGG + Intronic
1149100957 17:52906436-52906458 TTTCTATTACTAATGTGTGGTGG - Intergenic
1149828206 17:59848767-59848789 TTACTTTTACCCAAGTGTGGTGG - Intergenic
1150580989 17:66473531-66473553 CTACTGTTGTTCAAGTGTGTTGG + Intronic
1151434397 17:74086008-74086030 ATTCTCTTTTTCCAGTGTGGGGG - Intergenic
1151531077 17:74705142-74705164 TTTGTGTTAGTCCAGTGTGGTGG + Intronic
1152966337 18:118830-118852 TTTCTGTTTTTTAACTGTGTTGG + Intergenic
1153501924 18:5758395-5758417 TTTCTGTTATAAAATTGTGCAGG + Intergenic
1154927635 18:20953233-20953255 TTTCTGTTTTTTAACTGTGTTGG - Intronic
1155640871 18:28012779-28012801 TTTCTCTTATTTCAGTGTTGTGG - Intronic
1155743214 18:29316332-29316354 TTTCTGTTGTTGCAGTCTGGAGG - Intergenic
1156072040 18:33223346-33223368 TTTCTGTAATTTATGTGTGATGG - Intronic
1157033389 18:43940938-43940960 TTTCTGTTATTCAATTTTATAGG + Intergenic
1158001411 18:52623459-52623481 TTTTTGTTTCTAAAGTGTGGGGG + Intronic
1162857186 19:13477825-13477847 TTTCCATTATGCAACTGTGGTGG + Intronic
1164435709 19:28227390-28227412 TTTCTTTTGTTCATGTGTGTTGG - Intergenic
1168380140 19:55913372-55913394 TTTCTCTTATTCAAGTCTTTGGG - Intronic
926241018 2:11085251-11085273 ATTCAGTTAGTCAAGCGTGGCGG - Intergenic
926255993 2:11199472-11199494 TTTTTTTTATCCAGGTGTGGTGG - Intronic
927814068 2:26198746-26198768 TTTTAGTTAATCAAGAGTGGAGG + Intronic
928626859 2:33148838-33148860 TTTTGGTTATTCAAATTTGGGGG + Intronic
929393952 2:41500726-41500748 TTTCTGATATTCCATTCTGGGGG - Intergenic
929636450 2:43526595-43526617 TTTATCTTGTTCAAGTGTGTCGG + Intronic
936115372 2:109698311-109698333 TTTCTCTTAGCCAGGTGTGGTGG + Intergenic
936814494 2:116443483-116443505 ATTCTTTTATTCAAGTATTGTGG - Intergenic
938242934 2:129757130-129757152 TTTTGCTTATTCAAGTTTGGAGG - Intergenic
942476088 2:176322474-176322496 ATTCAGTTATTCAATTGGGGAGG - Intronic
942714900 2:178881104-178881126 TTTTTGTTCTTAAAGCGTGGTGG - Intronic
943026865 2:182640153-182640175 AAGCTGTTATTCAAGTGTGAAGG + Intergenic
943139598 2:183964327-183964349 TTTATTTTTTTCAAGAGTGGAGG + Intergenic
944316440 2:198290450-198290472 TTTCGGTTAGCCGAGTGTGGTGG - Intronic
944750923 2:202708755-202708777 TTTAAATTATTCAGGTGTGGTGG - Intronic
947336838 2:229094973-229094995 TATCTGTTATTAGAGTGTGGTGG - Intronic
948758023 2:240170288-240170310 TTTCACTTTCTCAAGTGTGGGGG + Intergenic
1169408735 20:5348931-5348953 TTTCTGTTCATCTAGGGTGGAGG - Intergenic
1170241910 20:14175428-14175450 TTTGTGCTAATGAAGTGTGGAGG + Intronic
1171526682 20:25818423-25818445 ATACAATTATTCAAGTGTGGTGG - Intronic
1171550145 20:26037462-26037484 ATACAATTATTCAAGTGTGGTGG + Intergenic
1172371910 20:34399910-34399932 TTTTAATTAGTCAAGTGTGGTGG - Intronic
1173063839 20:39690232-39690254 TTTCTGTTGTTGAAGTCTGCTGG - Intergenic
1176967952 21:15232628-15232650 TTTCTGTTGTTAAAGGCTGGAGG + Intergenic
1177157171 21:17512137-17512159 TTTCTGTTATGGAACTGTCGCGG + Intergenic
1177876582 21:26639676-26639698 TTTCTCATATTCCAGTGTGTGGG + Intergenic
1179001256 21:37461086-37461108 TTTCTGTTATTTAGTTGTTGAGG + Intronic
1181691147 22:24561699-24561721 TTTCTGTTATAAAAGTGGGGTGG + Intronic
1182276442 22:29192086-29192108 TTTTTGTTAGCCAGGTGTGGTGG + Intergenic
1182884295 22:33760173-33760195 CTTCTGAAATTCAAGTGTGGGGG + Intronic
949239930 3:1858913-1858935 TCTCTGTTCCTCAGGTGTGGTGG + Intergenic
949336804 3:2983839-2983861 TTACTATTATCCAAATGTGGGGG - Intronic
950030454 3:9848731-9848753 TGTCTGTTGTTCAAGTCTGCAGG - Intronic
954209989 3:49090795-49090817 TTTCTGTTATTAAATTGATGTGG - Intronic
957236954 3:77605805-77605827 TTTCTGTTACTCAGTTCTGGTGG + Intronic
957611086 3:82467395-82467417 TTCCTGTTTTCCAAGTGTGTAGG - Intergenic
958515761 3:95113334-95113356 ATTATGGTATTCAAGTGTGGTGG - Intergenic
959282133 3:104357515-104357537 TTTTTGTTATCCAAGTCTGTAGG + Intergenic
960936153 3:122904142-122904164 TTTCTCTTATTGAAGTGGTGGGG + Intergenic
963017797 3:140842216-140842238 TTTCTGATAGCCATGTGTGGTGG + Intergenic
963611359 3:147472842-147472864 GTTCTATTTTGCAAGTGTGGAGG - Intronic
963756861 3:149243483-149243505 TTACTGTGATTCTAGAGTGGGGG + Intergenic
966112085 3:176415413-176415435 TTTCTTTTTTTCAATTGTGAAGG + Intergenic
966208224 3:177426235-177426257 TTTCTGGTATTAACATGTGGGGG - Intergenic
968439317 4:613618-613640 TTTCTGTGATACATGTGTGGTGG + Intergenic
971515993 4:27486838-27486860 TTTCTGTATTCCAATTGTGGTGG - Intergenic
972146162 4:36028852-36028874 TCTCTGTTATACAAATGTAGGGG - Intronic
973103888 4:46306555-46306577 TACCTGTTACTCAACTGTGGAGG - Intronic
973898838 4:55445741-55445763 TTTATGTTAGCCAGGTGTGGTGG - Intronic
974396226 4:61338330-61338352 TTTCTGTTATTCATGTTTTCAGG + Intronic
976578364 4:86703714-86703736 TTTTAATTATCCAAGTGTGGTGG + Intronic
977099497 4:92792542-92792564 ATTATGTTATTCAACTTTGGGGG - Intronic
978248322 4:106602236-106602258 TTTCTTTTATTTCAGTGTGAGGG + Intergenic
979119594 4:116880654-116880676 TTTATGTTATGCAAGTATGTAGG - Intergenic
982664372 4:158243584-158243606 TTTAAGCTATTCAAGTTTGGTGG - Intronic
982759813 4:159267969-159267991 TTTCTGGTCTACAAGTGTGAAGG + Exonic
983791109 4:171798197-171798219 TTTATCTCATTCAAGTGAGGAGG + Intergenic
984394917 4:179185192-179185214 TCTCTATTATTCCTGTGTGGTGG - Intergenic
984800248 4:183709297-183709319 TCTGTCTTATTCAAGTTTGGGGG + Intronic
986282605 5:6335885-6335907 TTTATGTCATCCAAGGGTGGTGG - Intergenic
987499813 5:18694825-18694847 GTCCTTTTATTCAACTGTGGAGG + Intergenic
988594510 5:32579646-32579668 CTTATTTTATTCAATTGTGGAGG + Intronic
988694488 5:33606944-33606966 TTTCTGTTATTGAACTGTACTGG - Intronic
989456385 5:41648936-41648958 TTCCTCTGATTCAGGTGTGGGGG + Intergenic
990114418 5:52370274-52370296 TCTCTGATATACAAGTGGGGCGG + Intergenic
991108496 5:62869892-62869914 TTACTGTTATTCTGGTGTGTGGG + Intergenic
991211080 5:64105486-64105508 GTACTGTTATTCACGTGTGGTGG + Intergenic
993029559 5:82689675-82689697 TTTATGCTAATGAAGTGTGGTGG - Intergenic
993332382 5:86616876-86616898 GTTATGTTATTCATCTGTGGGGG - Intergenic
994152024 5:96458528-96458550 TTTCTTTTATTAAATTGTGGTGG - Intergenic
994919910 5:106030882-106030904 TTTAAGTTATCCAGGTGTGGTGG + Intergenic
995801924 5:116006174-116006196 TTTCTGTTTTCCAAGGGTGATGG + Intronic
997192722 5:131953446-131953468 TTTCTATTAGCCAGGTGTGGTGG + Exonic
998720908 5:144947733-144947755 TTTCTATTATTCATGGCTGGTGG - Intergenic
999446790 5:151646589-151646611 TCTCTGTGGTTCAAGTGTGAGGG + Intergenic
1000868488 5:166545193-166545215 TATCTGTTGTTCAATTGTTGAGG + Intergenic
1000950739 5:167479368-167479390 TTTCTGTTATTCAATAGTTTGGG - Intronic
1000978228 5:167788062-167788084 TTTCTGTTTTCCAAGTGGGTAGG + Intronic
1001240686 5:170067694-170067716 TTTCTGTTCTCCAAGTCTAGGGG + Intronic
1002295544 5:178228997-178229019 TTTCGGTTCCTCAAGTGTGCTGG + Intronic
1004782287 6:18922928-18922950 TTTCTGTTTTTTAATTTTGGGGG + Intergenic
1005060513 6:21772949-21772971 TTTCTGTCTTTCCAGGGTGGGGG - Intergenic
1005439902 6:25856386-25856408 TTTAAGTTAGCCAAGTGTGGTGG - Intronic
1006849406 6:37086791-37086813 TTTCTGCTTTCCAGGTGTGGTGG + Intergenic
1007463314 6:42034003-42034025 TTTAAGTTATCCAAGTATGGTGG + Intronic
1007669154 6:43537117-43537139 TTTTAATTATTCACGTGTGGTGG - Intronic
1008422219 6:51315015-51315037 TTTCTTTTATTCATGTATGGAGG + Intergenic
1008748531 6:54703380-54703402 TTGCTTTTCTTAAAGTGTGGTGG + Intergenic
1009007553 6:57806333-57806355 CTTCTGTGCTTCAATTGTGGTGG - Intergenic
1009790323 6:68393395-68393417 TTTTTGTTATTCAAATCTAGTGG + Intergenic
1010953507 6:82064519-82064541 TTTCAATTAGCCAAGTGTGGGGG - Intergenic
1012864651 6:104603825-104603847 TTTCTGTTTTTTAAGTGTTAAGG + Intergenic
1013780970 6:113727955-113727977 TGCCTGTCATTCCAGTGTGGAGG - Intergenic
1014244892 6:119057587-119057609 TTTTAATTATTCAGGTGTGGTGG + Intronic
1014644436 6:123955776-123955798 TTTAAGTTATTCAGGTGTGATGG - Intronic
1016235806 6:141864958-141864980 TTTCAATTAGCCAAGTGTGGTGG + Intergenic
1016834376 6:148462793-148462815 ATTCTGTTATACAAATGAGGAGG + Intronic
1019833244 7:3355028-3355050 TTTCTCTGATTAAATTGTGGTGG + Intronic
1021377665 7:19928283-19928305 TCTCTGTTATTCCAGTGCAGGGG + Intergenic
1021378154 7:19934469-19934491 TTTCTGTTATTCTAGAGCTGTGG - Intergenic
1021434139 7:20594989-20595011 TTTCTGTTTGGCAAGTGGGGAGG + Intergenic
1022294421 7:29036714-29036736 TTTCTAGCATTTAAGTGTGGGGG - Intronic
1023505232 7:40892684-40892706 TTTTAATTAGTCAAGTGTGGTGG - Intergenic
1023584648 7:41716579-41716601 TTGCAATTATTCAGGTGTGGTGG - Intergenic
1023788141 7:43728979-43729001 TTTCTGTTATTCAAGTGTGGTGG + Intronic
1024485203 7:49909954-49909976 TTTAAGTTACTCAGGTGTGGTGG + Intronic
1027535946 7:79401799-79401821 TTTCTGTTCATCACGTGTGGAGG - Intronic
1027967433 7:85029969-85029991 TTTTTTTTATTCAGGGGTGGAGG - Intronic
1028764589 7:94538555-94538577 TTTCTGTCAGTAAAGTGTAGGGG + Intronic
1029003925 7:97187085-97187107 TTTCAGTTATTCAAATCTGCAGG + Intergenic
1029264413 7:99326844-99326866 ATTCTGGTCTTCAAGTCTGGAGG - Intronic
1032812102 7:135430490-135430512 TTTTAATTATTCAGGTGTGGTGG + Intronic
1036944358 8:13080766-13080788 TTCCTGATATTCTTGTGTGGTGG + Intergenic
1037846450 8:22286932-22286954 TTTTTTTTAGTCAGGTGTGGTGG + Intronic
1037904268 8:22706200-22706222 CTTCTGCTCTTCCAGTGTGGTGG - Intergenic
1038638044 8:29303098-29303120 TTTCTAATATTCAGGGGTGGGGG - Intergenic
1038818015 8:30926088-30926110 TATCTGTTATTGCAGTGTAGTGG - Intergenic
1039202660 8:35113638-35113660 ATTCTTTTAAGCAAGTGTGGTGG + Intergenic
1039650384 8:39334863-39334885 TTTCTTTTATGCACGTGTGTGGG - Intergenic
1040025491 8:42778115-42778137 TTTTTGTTATGCAAGTCTAGTGG - Intronic
1042234036 8:66589919-66589941 TTTTTATTAGCCAAGTGTGGTGG + Intronic
1042524635 8:69751446-69751468 TGTCTGTCATTAAAATGTGGAGG + Intronic
1043508320 8:80924623-80924645 TTTCTGTCTTGCAGGTGTGGTGG + Intergenic
1045222188 8:100210282-100210304 TTTCTGTTAATGAGGTGTGTTGG + Intronic
1045366643 8:101482679-101482701 TCTCTGTTAACCAGGTGTGGTGG - Intergenic
1047737458 8:127778926-127778948 TTTCAATTAGCCAAGTGTGGTGG - Intergenic
1052300830 9:26950530-26950552 TTTTGCTTATTCTAGTGTGGAGG - Intronic
1052787445 9:32842715-32842737 TTTCTGTTGATCAAGTGAGTGGG + Intergenic
1054675630 9:67854134-67854156 TTTTTGTTGTTTAATTGTGGGGG + Intergenic
1055999279 9:82196837-82196859 TTTTTGTTATTGAAGAGGGGAGG - Intergenic
1056994043 9:91438364-91438386 TTTCTGCTATTGAATTGTAGGGG + Intergenic
1058534887 9:105948794-105948816 TTTCAGATAATCAAATGTGGAGG - Intergenic
1059623142 9:116031250-116031272 TTTCTTTTTTTCAAGCGTGAGGG - Intergenic
1185626909 X:1488871-1488893 ATTCAGTTATGCAAATGTGGAGG + Intronic
1186698379 X:12062626-12062648 TTTCTTTTCTTCATGTTTGGTGG + Intergenic
1187003203 X:15203698-15203720 TTACTGTTGTTCATGTGTGGAGG + Intergenic
1187975902 X:24704684-24704706 TCTCTGTTATTCAAGTAGTGTGG + Intronic
1188827715 X:34856668-34856690 TTTCTGTTAGTAAATTTTGGTGG + Intergenic
1190848578 X:54216335-54216357 TTTCTATTTCCCAAGTGTGGTGG + Intronic
1193616875 X:83699694-83699716 TTTCTGTTAGGCAGGTGTAGTGG + Intergenic
1194605203 X:95971436-95971458 TTTCTGCTATTTAGTTGTGGGGG + Intergenic
1195238486 X:102926553-102926575 TGTTTGTCATTCCAGTGTGGGGG + Intergenic
1196268523 X:113682301-113682323 TTTCTGTTATGTAAGTGTGGAGG - Intergenic
1197536935 X:127701773-127701795 TTACTTTTATTAAAGTGTTGTGG - Intergenic
1197908498 X:131453656-131453678 TTTCTGTTCTTGTTGTGTGGAGG + Intergenic
1199552831 X:149076955-149076977 TTTGTGTCATCCCAGTGTGGAGG - Intergenic