ID: 1023796013

View in Genome Browser
Species Human (GRCh38)
Location 7:43792907-43792929
Sequence CCCACAGTGCCAGTGTAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 208}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023796013_1023796023 22 Left 1023796013 7:43792907-43792929 CCTGGCTACACTGGCACTGTGGG 0: 1
1: 0
2: 1
3: 9
4: 208
Right 1023796023 7:43792952-43792974 CACACTGTAAACACAGATAGTGG 0: 1
1: 0
2: 2
3: 16
4: 193
1023796013_1023796025 26 Left 1023796013 7:43792907-43792929 CCTGGCTACACTGGCACTGTGGG 0: 1
1: 0
2: 1
3: 9
4: 208
Right 1023796025 7:43792956-43792978 CTGTAAACACAGATAGTGGAGGG 0: 1
1: 0
2: 0
3: 20
4: 279
1023796013_1023796024 25 Left 1023796013 7:43792907-43792929 CCTGGCTACACTGGCACTGTGGG 0: 1
1: 0
2: 1
3: 9
4: 208
Right 1023796024 7:43792955-43792977 ACTGTAAACACAGATAGTGGAGG 0: 1
1: 0
2: 1
3: 20
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023796013 Original CRISPR CCCACAGTGCCAGTGTAGCC AGG (reversed) Intronic
900118021 1:1036766-1036788 CCCACAGTCCAAGAGAAGCCTGG - Intronic
900381247 1:2385143-2385165 CCCGCAGTGCCTGCGGAGCCCGG - Intronic
900800234 1:4732626-4732648 CCCACTGTGCCTGTGCAGGCAGG + Intronic
902433848 1:16384326-16384348 CCCACAGTTCAAGAGCAGCCTGG + Intronic
903088101 1:20882408-20882430 CCCGGAGTTCCAGAGTAGCCTGG + Intronic
905207704 1:36352280-36352302 ACCCCAGTGCTAATGTAGCCAGG - Intronic
906525027 1:46488932-46488954 CCCACACTGCCAGTGGATGCAGG - Intergenic
907491670 1:54812489-54812511 CCCACAGTGCCAGGGGAGCTTGG + Intronic
907704570 1:56821235-56821257 CCCACTCTGCCAGTGTAGGCTGG - Intergenic
921149421 1:212387700-212387722 CCAACAGTGACAGAGTAGCTTGG + Intronic
922751675 1:228073085-228073107 CCCACAGAGCCAAAGTAGGCAGG - Intergenic
1063001344 10:1926643-1926665 CCAAGAGTGCCAGATTAGCCTGG + Intergenic
1063613117 10:7579985-7580007 CCCACAGTGGCATTGGAGACCGG - Exonic
1064320839 10:14303203-14303225 CCCACAGTTCTAGGGTAACCAGG + Intronic
1066341877 10:34542336-34542358 CACACACTGCCAGTGTCCCCTGG - Intronic
1066659866 10:37728522-37728544 CCCCCAGTGCCAGTGTGGGGGGG - Intergenic
1069004984 10:63307624-63307646 CCCCCAGTGCCAGTCTTACCTGG - Intronic
1069822994 10:71239121-71239143 CCCACAGTGCCAGTGACCCAGGG + Intronic
1071295537 10:84216827-84216849 CCCACCCTACCAGTGCAGCCCGG + Exonic
1072358305 10:94633702-94633724 CCCCCTGTGTCAGTGTGGCCTGG + Intergenic
1075557986 10:123447227-123447249 CCCTGAGTGCCACTGTAGCCAGG + Intergenic
1075641165 10:124065539-124065561 ACCCCAGGGCCAGTGAAGCCTGG - Intronic
1076251096 10:128984420-128984442 CCCACAGCCCCAGTGCAGCCAGG - Intergenic
1077111189 11:862910-862932 CCCCCAGCCCCAGTGTGGCCTGG - Intronic
1083764002 11:64833530-64833552 CCCACAGTGCCCATTCAGCCTGG + Intronic
1083781941 11:64923324-64923346 CCCACAGAGCCTCTGCAGCCAGG - Intronic
1084556499 11:69879187-69879209 GCCACAGTGGCAGGGCAGCCAGG + Intergenic
1084871448 11:72101247-72101269 CCCAAAGTGCGAGTGGAGCATGG + Intronic
1086064268 11:82730473-82730495 CCTACTGTGCAAGTGTATCCTGG + Exonic
1087750447 11:102001612-102001634 GCCAGGGTTCCAGTGTAGCCTGG - Intergenic
1089611524 11:119672134-119672156 CTCACATTTCCAGTGAAGCCCGG - Intronic
1089773274 11:120818282-120818304 CCGACAGGGGCAGGGTAGCCTGG - Intronic
1090262512 11:125331607-125331629 CCCATGGAGCCACTGTAGCCAGG - Intronic
1094205255 12:27832773-27832795 CCCACAGTGGCAGTGTAGAGAGG - Intergenic
1095914991 12:47468947-47468969 CCCAAAGTGCCATTGCACCCAGG + Intergenic
1096295046 12:50376691-50376713 CCCACATTGCCAGTTTAGGGTGG - Intronic
1097643375 12:62207820-62207842 CCCACATTGCCAGAGTATCTAGG + Intronic
1100752492 12:97714311-97714333 CCCACAGTGGATGTGTAGTCTGG + Intergenic
1102795828 12:115688073-115688095 CCCACAGATGCAGTGCAGCCTGG - Intergenic
1103611930 12:122129361-122129383 CCCAGCGTGCCAGACTAGCCTGG + Intronic
1104805440 12:131586571-131586593 TCCACAGAGCCAGTGGAGCTGGG + Intergenic
1106467471 13:30025626-30025648 CTCACAGTGCCTGGGTATCCTGG + Intergenic
1107346694 13:39469220-39469242 CACACAGTGCCTGTGTTGCAGGG - Intronic
1107757859 13:43645196-43645218 GCCACCGTGCTAGTCTAGCCTGG - Intronic
1112752616 13:102597397-102597419 CGCACAGTGCCAGGGTCGCTGGG + Intronic
1113897885 13:113777379-113777401 CCAACAGTGCCTGTCAAGCCTGG + Intronic
1113940249 13:114015099-114015121 CCCGCAGTTCTAGTCTAGCCAGG + Intronic
1115632124 14:35255586-35255608 CCAGCAGTTCAAGTGTAGCCTGG - Intronic
1116269352 14:42741605-42741627 CCAACAGTGGCAGTGTGGTCTGG + Intergenic
1118001257 14:61525973-61525995 CCCGCAGTCCCAGAGGAGCCAGG + Intronic
1118259351 14:64233130-64233152 CCCACAGTCTCAGTGACGCCTGG - Exonic
1120980927 14:90288321-90288343 CCCACAGTGCCAGCAAAACCAGG - Exonic
1121532371 14:94664512-94664534 CCCAGAGTGGCAGTGGGGCCTGG - Intergenic
1122349847 14:101082791-101082813 CCCACAGTCCCCGTGGAGCTGGG - Intergenic
1122632442 14:103113119-103113141 CCCCCAGTGCCACCGTGGCCTGG + Intergenic
1123552799 15:21398863-21398885 CCCACAGAGCCATACTAGCCCGG + Intergenic
1123553017 15:21400143-21400165 CCCACAGAGCCATACTAGCCCGG + Intergenic
1123589045 15:21836251-21836273 CCCACAGAGCCATACTAGCCCGG + Intergenic
1123589262 15:21837531-21837553 CCCACAGAGCCATACTAGCCCGG + Intergenic
1126142268 15:45448326-45448348 CCCCCAGAGCCAGGGGAGCCAGG - Intronic
1127169677 15:56288135-56288157 CCCACAGTGACAGTGTACAAGGG + Intronic
1129020903 15:72517311-72517333 CCCAGAGTTCGAGTGAAGCCTGG - Intronic
1131049734 15:89338802-89338824 CCAGCAGTTCCAGTCTAGCCTGG + Intergenic
1132085795 15:98907404-98907426 CCTGCAGAGCCAGCGTAGCCAGG - Intronic
1132293471 15:100719076-100719098 CTCACAGTGCCAGGGTGGGCAGG + Intergenic
1132293481 15:100719119-100719141 CTCACAGTGCCAGGGTGGGCAGG + Intergenic
1132293491 15:100719162-100719184 CTCACAGTGCCAGGGTGGGCAGG + Intergenic
1132293501 15:100719205-100719227 CTCACAGTGCCAGGGTGGGCAGG + Intergenic
1132293511 15:100719248-100719270 CTCACAGTGCCAGGGTGGGCAGG + Intergenic
1132293521 15:100719291-100719313 CTCACAGTGCCAGGGTGGGCAGG + Intergenic
1132293531 15:100719334-100719356 CTCACAGTGCCAGGGTGGGCAGG + Intergenic
1132293541 15:100719377-100719399 CTCACAGTGCCAGGGTGGGCAGG + Intergenic
1132293551 15:100719420-100719442 CTCACAGTGCCAGGGTGGGCAGG + Intergenic
1132293561 15:100719463-100719485 CTCACAGTGCCAGGGTGGGCAGG + Intergenic
1132293571 15:100719506-100719528 CTCACAGTGCCAGGGTGGGCAGG + Intergenic
1132293591 15:100719592-100719614 CTCACAGTGCCAGGGTGGGCAGG + Intergenic
1132293601 15:100719635-100719657 CTCACAGTGCCAGGGTGGGCAGG + Intergenic
1132293611 15:100719678-100719700 CTCACAGTGCCAGGGTGGGCAGG + Intergenic
1132293621 15:100719721-100719743 CTCACAGTGCCAGGGTGGGCAGG + Intergenic
1132293631 15:100719764-100719786 CTCACAGTGCCAGGGTGGGCAGG + Intergenic
1132293641 15:100719807-100719829 CTCACAGTGCCAGGGTGGGCAGG + Intergenic
1132293651 15:100719850-100719872 CTCACAGTGCCAGGGTGGGCAGG + Intergenic
1132293661 15:100719893-100719915 CTCACAGTGCCAGGGTGGGCAGG + Intergenic
1132293671 15:100719936-100719958 CTCACAGTGCCAGGGTGGGCAGG + Intergenic
1132293681 15:100719979-100720001 CTCACAGTGCCAGGGTGGGCAGG + Intergenic
1132293691 15:100720022-100720044 CTCACAGTGCCAGGGTGGGCAGG + Intergenic
1132293701 15:100720065-100720087 CTCACAGTGCCAGGGTGGGCAGG + Intergenic
1132293711 15:100720108-100720130 CTCACAGTGCCAGGGTGGGCAGG + Intergenic
1132293721 15:100720151-100720173 CTCACAGTGCCAGGGTGGGCAGG + Intergenic
1132293731 15:100720194-100720216 CTCACAGTGCCAGGGTGGGCAGG + Intergenic
1132293741 15:100720237-100720259 CTCACAGTGCCAGGGTGGGCAGG + Intergenic
1132358229 15:101189484-101189506 CACACAGGCCCAGTGCAGCCGGG + Intronic
1202961149 15_KI270727v1_random:126083-126105 CCCACAGAGCCATACTAGCCCGG + Intergenic
1202961365 15_KI270727v1_random:127363-127385 CCCACAGAGCCATACTAGCCCGG + Intergenic
1132676200 16:1122332-1122354 CCCACAGTTCCAGGGTGGGCAGG + Intergenic
1132997870 16:2832645-2832667 CCCCCAGTGCCAGGCGAGCCTGG - Intronic
1137734121 16:50711558-50711580 CCCACAGAGCCAGTCTGCCCAGG - Exonic
1139960752 16:70716085-70716107 CCCACAGCGTCAGTAGAGCCAGG - Intronic
1141427535 16:83953619-83953641 GCCACAGTCCCAGCGTACCCTGG + Intronic
1141775980 16:86122726-86122748 CCCACAGTCCCAGAGCAGCCAGG - Intergenic
1142497470 17:314029-314051 CCCACAGCTCCAGAGTAGCGTGG + Intronic
1144629646 17:16864461-16864483 CTGGCAGTGCCACTGTAGCCAGG + Intergenic
1144651782 17:17011656-17011678 CTGGCAGTGCCACTGTAGCCAGG - Intergenic
1144727981 17:17511353-17511375 CCCACAGTCCCAGAGAGGCCTGG + Intronic
1147753381 17:42751270-42751292 CCCAAAGTGTCTCTGTAGCCTGG - Intergenic
1148074691 17:44928524-44928546 GTCACAGGGCCAGTGTATCCTGG + Exonic
1152658442 17:81530680-81530702 CCCAGAGTGTCAGTGTACCCAGG - Intronic
1157506638 18:48231098-48231120 TCCACAGTGCCAGTGCGCCCAGG - Intronic
1158220220 18:55142682-55142704 CCATCAGTGATAGTGTAGCCAGG + Intergenic
1163146538 19:15383251-15383273 CACACAATGGCAGTGCAGCCTGG - Intronic
1163823269 19:19508390-19508412 CCCACAGTGCTAGTTGTGCCTGG + Exonic
1164389385 19:27805072-27805094 CCCAGGGTGCCCGTGTGGCCTGG - Intergenic
1164567906 19:29341349-29341371 CCCACACTCCCAGTGCAGTCTGG + Intergenic
1166785080 19:45362798-45362820 CCCACAGAGGCAGGGCAGCCAGG + Intronic
1168550386 19:57288401-57288423 CCCAGAGTTCAAGAGTAGCCTGG - Intronic
926299349 2:11590893-11590915 TCAACTGTGCCAGTGTGGCCGGG + Intronic
926351452 2:11999023-11999045 TCCATTGTGCCAGTGTAGCTTGG + Intergenic
930206962 2:48597358-48597380 CCCACAGTCCCAGTGAAGTTAGG + Exonic
930606217 2:53496105-53496127 CCCACAGTCCCACAGCAGCCAGG + Intergenic
932891254 2:75598904-75598926 CCCTCAGGGCCAGTGTTGTCAGG - Intergenic
937355635 2:121196494-121196516 CCCCCACACCCAGTGTAGCCCGG + Intergenic
937791970 2:125971592-125971614 CCCAGAGGGCCAAGGTAGCCTGG + Intergenic
938893476 2:135728148-135728170 CCCACAGTTCCAGATTAGCTTGG + Intergenic
942240430 2:173959605-173959627 CCCAGAGTCCCAGAGTAGCTGGG - Intronic
942898772 2:181089632-181089654 GCCACAAAGCCACTGTAGCCAGG + Intergenic
946159771 2:217828952-217828974 CCAACATTGCCAGTGTCCCCTGG - Intronic
946196484 2:218035415-218035437 CACACAGTGAGTGTGTAGCCAGG + Intronic
946239417 2:218344801-218344823 CCCACAGTGCCCATCTACCCTGG + Exonic
948131517 2:235604218-235604240 CCCAAAGTGCCAGTATTACCAGG - Intronic
948421503 2:237863209-237863231 CCACCAGGGCCACTGTAGCCCGG - Intronic
948448405 2:238051987-238052009 CCAAGAGTGCAAGTCTAGCCTGG - Intronic
948469328 2:238167194-238167216 CCCACAGAGCCACTGCAGGCAGG + Intronic
948804520 2:240447709-240447731 CCCACAGTCGCTGTGTACCCTGG + Intronic
949044897 2:241867916-241867938 CCCCCAGAGCCAGTGTTTCCTGG - Intergenic
1169248812 20:4044836-4044858 CCCACTCTGCCAGTGTAGCCTGG - Intergenic
1172284592 20:33731962-33731984 CCCACAATGCTCGCGTAGCCGGG + Exonic
1173300131 20:41794970-41794992 CCCTGGGTGCCAGGGTAGCCTGG - Intergenic
1174722200 20:52824727-52824749 GCCCCAGTGCCAGTGAAACCAGG - Intergenic
1175855004 20:62116113-62116135 CCCACTGTCCCAGCGGAGCCAGG - Intergenic
1175896429 20:62337848-62337870 CAGGCAGTGCCTGTGTAGCCGGG + Exonic
1178294130 21:31394769-31394791 CACACACTGCCAGAGGAGCCAGG + Intronic
1178446096 21:32644380-32644402 CTCACTGTGCATGTGTAGCCTGG - Intronic
1178563825 21:33664516-33664538 CCCACTGTGGCAGTGTAGGGAGG - Intronic
1180641723 22:17304353-17304375 CACAGAGTGCCAGAGAAGCCCGG - Intergenic
1181427036 22:22850394-22850416 CCCTCAGTGTCAGTGTCACCAGG + Intronic
1183850341 22:40580820-40580842 CCAGGAGTTCCAGTGTAGCCTGG - Intronic
1183950697 22:41351150-41351172 CCCTAAGTGCCAGTGAGGCCAGG + Intronic
953026335 3:39147375-39147397 CCCAGAGTGCCTGGCTAGCCTGG - Intronic
953034103 3:39196809-39196831 CAGCCAGTGCCAGGGTAGCCAGG - Intergenic
953383781 3:42493264-42493286 CCCACAGTGGCAAGGTAGGCTGG - Intronic
953551863 3:43909359-43909381 CCCACTTTCCCAGTGCAGCCAGG + Intergenic
954414519 3:50386606-50386628 TCCACAGTGCCAGGCTGGCCTGG - Intronic
954582790 3:51712132-51712154 CCCTCTGCCCCAGTGTAGCCAGG + Intronic
961128902 3:124446986-124447008 CCCCCCTTGCCACTGTAGCCAGG - Intronic
961447153 3:126986228-126986250 CTCACAGTGGCAGTGGGGCCGGG - Intergenic
962084473 3:132175614-132175636 CCCAGAGTGCTGGTGGAGCCAGG - Intronic
962868234 3:139465659-139465681 CCCACAGTCCCTGTGTCTCCAGG - Intronic
965208396 3:165751474-165751496 ACCACTCTGCCAGTGGAGCCTGG - Intergenic
966805734 3:183805960-183805982 CACACAATGTCAGTGAAGCCCGG - Intronic
968504112 4:964139-964161 CCCACAGAGCGAGTGGAGCTGGG + Intronic
969108202 4:4823979-4824001 GCCACAGGGCCAGAGCAGCCTGG - Intergenic
971097645 4:23426092-23426114 CCCAATGTGGCAGTGTAGGCTGG + Intergenic
971280095 4:25235660-25235682 CCCAAATTGCCAATGTAGCTAGG - Intronic
975890135 4:79017709-79017731 CCCACACTGTCAGTGTTCCCTGG + Intergenic
980093822 4:128469059-128469081 CCCACAATGCCAGTTTGGACAGG + Intergenic
985085343 4:186307566-186307588 GCCAGAGTGCCAGTCTAGCCTGG - Intergenic
986452694 5:7882013-7882035 CAGTCAGTGCCAGGGTAGCCTGG - Intronic
987117310 5:14736123-14736145 CACACTGTGCCAGCGTGGCCAGG + Intronic
987337917 5:16913564-16913586 CCCAGAGTGCCAGGGAAGGCTGG + Intronic
987358923 5:17089093-17089115 CCCAGAGTTCCAGTCCAGCCTGG - Intronic
989115835 5:37951602-37951624 CCAACAGTGCAAGACTAGCCTGG - Intergenic
990607747 5:57427479-57427501 CCCACAAGGGCTGTGTAGCCAGG + Intergenic
991104573 5:62829921-62829943 CTTAAAGTGCCAGTGTAGCAGGG + Intergenic
992025629 5:72666283-72666305 CCTACAGTGTTAGTGGAGCCAGG + Intergenic
998223867 5:140311053-140311075 CCCACAGTGCCAAAGTTCCCAGG + Intergenic
999426187 5:151489518-151489540 CCCACACTGCCTCTGTGGCCTGG + Exonic
999661455 5:153867487-153867509 ACCACAGTGCCTTTGTGGCCAGG - Intergenic
1000999214 5:167989633-167989655 GCCACAGTGCCAGTGTGCTCTGG - Intronic
1002211422 5:177601738-177601760 CCCTCAGAGCCAGGGTGGCCTGG + Intronic
1005147809 6:22711536-22711558 CCAACAGTGTGAGCGTAGCCAGG - Intergenic
1006780818 6:36631229-36631251 CCCACACTGCCAGTGGGGACAGG - Intergenic
1006830407 6:36964685-36964707 CCCTGAGTGCCTGTGTAGCTGGG + Exonic
1007230352 6:40343804-40343826 CCCACAGGGCCAAGGCAGCCTGG + Intergenic
1007786761 6:44284695-44284717 CTCCCTGTGCCAGTGTGGCCAGG + Intronic
1008683228 6:53896507-53896529 CTCTCAGTTCCAGTGAAGCCAGG - Exonic
1015799655 6:137047190-137047212 CCCACAGTGCCTCTTTACCCTGG + Intergenic
1015889085 6:137951438-137951460 CACACAGTGCCTGTGTTGCAGGG - Intergenic
1019494520 7:1331572-1331594 CCCAGAGAGGCAGTGCAGCCTGG + Intergenic
1019993209 7:4706845-4706867 CCCCCAATGCCCCTGTAGCCTGG + Intronic
1023796013 7:43792907-43792929 CCCACAGTGCCAGTGTAGCCAGG - Intronic
1025713538 7:63932318-63932340 CCCAGGGTGCCCGTGTGGCCTGG + Intergenic
1027448805 7:78305408-78305430 GGTAGAGTGCCAGTGTAGCCTGG + Intronic
1029357230 7:100061137-100061159 CCAACAGTAACAGTGCAGCCTGG + Intronic
1029489115 7:100860818-100860840 CCCAAAGTGTCAGTGAACCCTGG - Intronic
1029713679 7:102314158-102314180 GCCACAGAGCCAGTGTAGGGTGG + Intronic
1029724868 7:102396135-102396157 CCCTCCGTGCCTGAGTAGCCTGG - Exonic
1033544705 7:142389368-142389390 CCCACAGGCCCAGTGGAGGCTGG + Intergenic
1033940404 7:146645438-146645460 GCCACAGTGCCAGTGGAGAAGGG + Intronic
1035170614 7:157015376-157015398 CTCACATTGCCAGTGCAGCCTGG - Intergenic
1047472021 8:125184795-125184817 CCCACAGTATTTGTGTAGCCAGG + Intronic
1048494272 8:134922273-134922295 CTCACAGTGCAAGTAGAGCCTGG + Intergenic
1049987440 9:964886-964908 CCCACAGTGCCACTGACGCTAGG + Intronic
1050868164 9:10530991-10531013 CGCACAGTGGCACTTTAGCCTGG - Intronic
1051136635 9:13930123-13930145 CCCACCGTCAAAGTGTAGCCTGG + Intergenic
1052974687 9:34402021-34402043 CCCAAAGTCCAAGTCTAGCCAGG + Intronic
1056098317 9:83276500-83276522 CCCACAGTTCCAGAAGAGCCTGG - Intronic
1057567432 9:96178161-96178183 CCCACAGTGCCTGAGTAGTGTGG + Intergenic
1058427369 9:104886589-104886611 TCTACAGTGCCAGTGTCTCCTGG - Intronic
1059824786 9:118017066-118017088 CCCAAAGTTCCAGTGGACCCAGG - Intergenic
1059949694 9:119449340-119449362 ATCACAGTGCCAGTATGGCCAGG - Intergenic
1061077952 9:128353195-128353217 CACAGAGTGCAACTGTAGCCTGG + Exonic
1061366659 9:130175529-130175551 ACCACAGTTCCAGTGTATGCTGG + Intronic
1061412056 9:130427207-130427229 CCCCCACTGCCAGCTTAGCCAGG - Intronic
1062437765 9:136554226-136554248 TCCACAGGGCCAGGGTGGCCAGG - Intergenic
1189234532 X:39477226-39477248 CCCACAGTGGCTGTGCAGCTGGG - Intergenic
1189511961 X:41671938-41671960 CCTACAGAGCCATTGTATCCTGG + Intronic
1192166226 X:68829249-68829271 CCCGGAGTCCCAGTGTGGCCCGG + Exonic
1195567939 X:106363779-106363801 ACCACTGTCCCAGTGGAGCCAGG - Intergenic
1199420579 X:147639231-147639253 CCTACAGTGCCACTGTTGCTTGG - Intergenic