ID: 1023796025

View in Genome Browser
Species Human (GRCh38)
Location 7:43792956-43792978
Sequence CTGTAAACACAGATAGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 279}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023796015_1023796025 1 Left 1023796015 7:43792932-43792954 CCCAACTGCCTCCTCACCCCCAC 0: 1
1: 0
2: 8
3: 83
4: 691
Right 1023796025 7:43792956-43792978 CTGTAAACACAGATAGTGGAGGG 0: 1
1: 0
2: 0
3: 20
4: 279
1023796016_1023796025 0 Left 1023796016 7:43792933-43792955 CCAACTGCCTCCTCACCCCCACA 0: 1
1: 0
2: 9
3: 110
4: 999
Right 1023796025 7:43792956-43792978 CTGTAAACACAGATAGTGGAGGG 0: 1
1: 0
2: 0
3: 20
4: 279
1023796011_1023796025 29 Left 1023796011 7:43792904-43792926 CCTCCTGGCTACACTGGCACTGT 0: 1
1: 0
2: 1
3: 11
4: 181
Right 1023796025 7:43792956-43792978 CTGTAAACACAGATAGTGGAGGG 0: 1
1: 0
2: 0
3: 20
4: 279
1023796017_1023796025 -7 Left 1023796017 7:43792940-43792962 CCTCCTCACCCCCACACTGTAAA 0: 1
1: 0
2: 1
3: 40
4: 396
Right 1023796025 7:43792956-43792978 CTGTAAACACAGATAGTGGAGGG 0: 1
1: 0
2: 0
3: 20
4: 279
1023796013_1023796025 26 Left 1023796013 7:43792907-43792929 CCTGGCTACACTGGCACTGTGGG 0: 1
1: 0
2: 1
3: 9
4: 208
Right 1023796025 7:43792956-43792978 CTGTAAACACAGATAGTGGAGGG 0: 1
1: 0
2: 0
3: 20
4: 279
1023796018_1023796025 -10 Left 1023796018 7:43792943-43792965 CCTCACCCCCACACTGTAAACAC 0: 1
1: 0
2: 5
3: 37
4: 402
Right 1023796025 7:43792956-43792978 CTGTAAACACAGATAGTGGAGGG 0: 1
1: 0
2: 0
3: 20
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023796025 Original CRISPR CTGTAAACACAGATAGTGGA GGG Intronic
901037562 1:6345463-6345485 CTGTAAACACAGATAATAAATGG + Intronic
901557342 1:10042055-10042077 CTGTAATCCCAGATACTCGAGGG - Intronic
901609258 1:10484148-10484170 CTGTAATCCCAGCTACTGGAAGG - Intronic
903441521 1:23391518-23391540 CTGTAACCTCACATGGTGGAGGG - Intronic
903850427 1:26302521-26302543 CTGCAAACACAGATGGTCTACGG - Intronic
905573532 1:39025477-39025499 CTGTAATCCCAGCTAGTGGGGGG - Intergenic
906978919 1:50607474-50607496 CTGTATACAAAAATAGTGGGAGG - Intronic
907351257 1:53833280-53833302 CTGTAATCCCAGCTACTGGAAGG - Intronic
907582557 1:55585024-55585046 CTGCAGACGCAGATATTGGAAGG - Intergenic
909192009 1:72565379-72565401 CTGTAATCCCAGCTACTGGAGGG - Intergenic
910932790 1:92459254-92459276 CTGTAATCACAGCTACTGGGAGG - Intergenic
911573444 1:99545406-99545428 ATGTAAAAACATATACTGGAGGG - Intergenic
911811279 1:102284941-102284963 GAGTAAACACAGACAGTGGCAGG + Intergenic
912152522 1:106878079-106878101 CTGGACAAACAGTTAGTGGAGGG - Intergenic
912209971 1:107546597-107546619 AGGTAAACACAGAAGGTGGATGG - Intergenic
912919172 1:113849019-113849041 CTGGAAAAAGAGATAGTGGTTGG + Intronic
917246012 1:173001498-173001520 CTGTAAACACAGAAATTCAAAGG - Intergenic
918337435 1:183532485-183532507 CTGTGAACACAGTTATTAGAAGG + Intronic
918519057 1:185394849-185394871 CTGTAAACACAGATAGTTCTGGG - Intergenic
920662308 1:207925763-207925785 CTGTAATCACAGCTAGTAGGAGG + Intergenic
922469631 1:225867973-225867995 CTGGAAGGACAGGTAGTGGATGG + Exonic
923899495 1:238310436-238310458 CTGTAATCCCAGATAGTCGGGGG - Intergenic
924440101 1:244078813-244078835 CTGTAATCCCAGCTACTGGAGGG - Intergenic
1064347986 10:14549801-14549823 CTGTCCATACAGATAGTGAAAGG - Intronic
1065128535 10:22597505-22597527 TTGTAAGCAGAGAAAGTGGATGG - Intronic
1066434172 10:35381436-35381458 CTGTAATCCCAGCTACTGGAGGG + Intronic
1067014077 10:42742736-42742758 CTGAAAACACTGATATAGGAGGG - Intergenic
1068878214 10:62020362-62020384 TTTTAAACACAGATGGGGGAGGG - Intronic
1069449138 10:68502071-68502093 CTGTAATCCCAGCTACTGGAGGG + Intronic
1069590681 10:69639865-69639887 CTGAAAACTCAAATACTGGAAGG - Intergenic
1072000431 10:91190166-91190188 CTGTGACCTCACATAGTGGAAGG + Intronic
1072642373 10:97221612-97221634 CTGTAACCTCACATGGTGGAAGG - Intronic
1074896150 10:117779234-117779256 CTCAAAACACAAATAGTAGAAGG - Intergenic
1075056329 10:119221385-119221407 CTATAAACACAGATATGGAAAGG - Intronic
1075113909 10:119610091-119610113 CTGTAATCTCAGCTACTGGAGGG - Intergenic
1075219963 10:120576336-120576358 CTGCAAAGACAGAGAGAGGAAGG - Intronic
1077033872 11:484485-484507 CTGTAAACACAGCCAGTGCAGGG + Intronic
1078712129 11:13803622-13803644 CTGTAATCTCACACAGTGGAAGG - Intergenic
1079091589 11:17484348-17484370 CTGTAAACTTACATGGTGGAAGG - Intergenic
1079578413 11:22031429-22031451 CTGTAATCCCAGCTACTGGAGGG - Intergenic
1079735179 11:23988456-23988478 CTCTAAACCCAGGTAGTGGAAGG + Intergenic
1081483312 11:43508277-43508299 CTTTAAACACAGGAAGGGGAGGG + Intergenic
1082758226 11:57099480-57099502 ATGATAACACAGCTAGTGGATGG - Intergenic
1084749011 11:71191679-71191701 CTGTAATCACAGCTACTGGGAGG - Intronic
1085754033 11:79189114-79189136 ATGTAAACACAGATATGGTATGG + Intronic
1086128906 11:83380369-83380391 CTGTAACCTCATACAGTGGAAGG - Intergenic
1086362530 11:86073701-86073723 GTGTAAACACAGAAAGGTGAGGG - Intergenic
1088101029 11:106155852-106155874 CTGTAATCCCAGTTACTGGAGGG - Intergenic
1089469799 11:118711530-118711552 CTGAAAATACAGGTAATGGAAGG + Intergenic
1090587933 11:128234379-128234401 CTGTAAACTCAGACAGTGATGGG + Intergenic
1090589258 11:128247435-128247457 CTGTTAATTCAGATTGTGGATGG - Intergenic
1091496191 12:974910-974932 CTGTAACCACAGGTGTTGGAAGG - Intronic
1092254494 12:6918857-6918879 CTGTAATCACAGATACTAGCGGG + Intronic
1093051817 12:14512838-14512860 CTGTGACCTCACATAGTGGAAGG - Intronic
1093231130 12:16543332-16543354 CCGTAGTCAGAGATAGTGGATGG - Intronic
1094336107 12:29356142-29356164 CTGTAATCCCAGATACTCGAGGG - Intronic
1096384545 12:51186379-51186401 CTGTAACCTCACATGGTGGAAGG - Intergenic
1096880633 12:54666200-54666222 CTGTAAACACAAAAAGGGGAGGG - Intergenic
1098132836 12:67368360-67368382 CTGGAAACACAGAGAAAGGATGG + Intergenic
1099384002 12:81992000-81992022 GTGTATTCACAGAAAGTGGATGG + Intergenic
1100763791 12:97839989-97840011 ATGTTAACACAAAAAGTGGAAGG - Intergenic
1101694444 12:107111589-107111611 TTGTAAACAGAGCTAGTTGAAGG + Intergenic
1101953970 12:109197599-109197621 CTGAACAAACAGATAGTGGCAGG + Intronic
1102741717 12:115213522-115213544 CTGCAAAGAAAAATAGTGGAAGG - Intergenic
1103526922 12:121575298-121575320 ATGAAAACAGACATAGTGGAGGG + Intronic
1106329349 13:28725064-28725086 CTCTAAGCACAAATTGTGGAAGG + Intergenic
1106820276 13:33456739-33456761 CTGTATTCCCACATAGTGGAAGG - Intergenic
1107723365 13:43273097-43273119 TTGTAAACACAGGAAGTGAAGGG - Intronic
1108320187 13:49281934-49281956 CTGTAATCCCAGATACTGGGGGG - Intronic
1108334729 13:49427883-49427905 CTGTATCCTCACATAGTGGAAGG + Intronic
1108699903 13:52934758-52934780 CTGTAATCCCAGCTACTGGAAGG + Intergenic
1108827331 13:54429656-54429678 CTGGAGACAGAGATAGTGAAAGG - Intergenic
1109111367 13:58323584-58323606 TTTTAAACACAGAAAGTGTAGGG + Intergenic
1109994359 13:70103930-70103952 CTGTAAAGACAGTTTATGGATGG + Intronic
1109995255 13:70115203-70115225 CTCTGAACACACATAGTAGAAGG + Intergenic
1110485353 13:76034773-76034795 CTGTAATCACAGCTACTGGGAGG + Intergenic
1110820127 13:79905510-79905532 CTGTAAAAAGACATACTGGATGG - Intergenic
1112488264 13:99839359-99839381 GTGTAAACACAGCCACTGGATGG - Intronic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1115324349 14:32121772-32121794 CTGTAAAGGCAGAAAGTTGATGG - Intronic
1117180399 14:53185496-53185518 CTGTGTACTCACATAGTGGAAGG + Intergenic
1117695527 14:58358343-58358365 CTGTAATCCCAGATATTGGGAGG + Intronic
1118389231 14:65282244-65282266 CTGTAATCTCAGAGAGAGGATGG - Intergenic
1118407943 14:65445293-65445315 CTGTAAACACTCATGGTGAAAGG - Intronic
1121726287 14:96153433-96153455 CTGTAATCTCAGCTAGTTGAGGG - Intergenic
1124648494 15:31457521-31457543 TTTTAAACACATATAGTAGAAGG - Intergenic
1125348696 15:38745046-38745068 CTGTCATCACTGATAGTTGAAGG - Intergenic
1126361509 15:47851171-47851193 ATATAAACTTAGATAGTGGATGG + Intergenic
1126766461 15:52015932-52015954 CTGTAATCCCAGCTACTGGAAGG + Intronic
1127251218 15:57240442-57240464 CTGATAACACTGATGGTGGATGG - Intronic
1128457817 15:67842524-67842546 CTGAAAACACAGATATTAGCCGG - Intergenic
1128826459 15:70722052-70722074 CTGAAAACTCAGATAAGGGATGG + Intronic
1130101354 15:80896648-80896670 CTGGAATCACAGATTGTTGAAGG + Intronic
1130249319 15:82286847-82286869 GTCTTAACACAGATATTGGATGG - Intergenic
1130450747 15:84049347-84049369 GTTTTAACACAGATATTGGATGG + Intergenic
1131337863 15:91567059-91567081 GTGAAAACACAGATTCTGGAAGG + Intergenic
1134182463 16:12058913-12058935 CTGTAGACCCAGCTACTGGAGGG - Intronic
1137687866 16:50399417-50399439 CTGTAATGACAGATGGTGGAGGG + Intergenic
1138241519 16:55431186-55431208 CTGTAATCCCAGCTATTGGAAGG - Intronic
1138247488 16:55478669-55478691 ATGGAAACAGAGACAGTGGAAGG - Intronic
1138857848 16:60716194-60716216 CTGTAAACACAGATTTTGAAAGG - Intergenic
1140598674 16:76447989-76448011 CTAGAAACAAAGATAGTAGAAGG - Intronic
1140817652 16:78635788-78635810 TTGGAAAAACAGCTAGTGGAAGG + Intronic
1140932409 16:79640045-79640067 CTGAACACACAGAAAGTGGTAGG + Intergenic
1141566427 16:84905519-84905541 CTGTAATCCCAGCTAGTTGAAGG - Intronic
1143208160 17:5161319-5161341 CTGTAAGCCCAGATAGAGGATGG + Intronic
1145266458 17:21381880-21381902 CAGTAAACACAGAGAGTGAATGG + Intronic
1146982726 17:37181025-37181047 CTGCCAACTCAGATATTGGATGG - Intronic
1148168053 17:45497574-45497596 CTGTAGTCCCAGATATTGGAGGG + Intergenic
1148280764 17:46345383-46345405 CTGTAGTCCCAGATATTGGAGGG - Intronic
1148302992 17:46563318-46563340 CTGTAGTCCCAGATATTGGAGGG - Intronic
1148455513 17:47809064-47809086 CTGGAAACCCAGTAAGTGGAGGG - Exonic
1149872241 17:60193117-60193139 CTGTAAGCCCAGATAGAGGATGG - Intronic
1150399237 17:64843990-64844012 CTGTAGTCCCAGATATTGGAGGG + Intergenic
1151670570 17:75569679-75569701 CTGTAATCCCAGCTACTGGAAGG + Intronic
1153157263 18:2163684-2163706 ATATAATCAAAGATAGTGGAAGG - Intergenic
1155731558 18:29166064-29166086 CTGTGAACACAGAGAGTAGAGGG - Intergenic
1162984749 19:14262477-14262499 CTGTAATCCCAGATACTTGAGGG - Intergenic
1163410542 19:17151154-17151176 CTGTAATCTCAGCTACTGGAAGG + Intronic
1164393800 19:27846798-27846820 CTGGACAAACAGATACTGGAGGG + Intergenic
1164449173 19:28345167-28345189 GTGTAAGCACAGGAAGTGGAAGG + Intergenic
1164781063 19:30893253-30893275 CTGAAAACACAGATGGAGAATGG + Intergenic
1167950988 19:53027640-53027662 CTGTAATCACAGCTATTGGGAGG - Intergenic
1168471631 19:56644879-56644901 CTGTAGTCTCAGATATTGGAAGG - Intronic
1168704064 19:58458288-58458310 CTGTAATCCCAGCTACTGGAGGG - Intergenic
925100527 2:1240831-1240853 ATGTAAACAAAAATAGTTGATGG - Intronic
927441209 2:23119341-23119363 CTGTCCACACAGATGGTGGAGGG + Intergenic
927934606 2:27069265-27069287 CTGTGTAGAAAGATAGTGGAGGG - Intronic
929683844 2:44017579-44017601 CTGTAGACCCAGCTAGTTGAGGG + Intergenic
929985833 2:46731289-46731311 CTGTAACCTCACATGGTGGAAGG - Intronic
931987263 2:67754080-67754102 CTGTAACCTCACATAGTGGAAGG - Intergenic
932297839 2:70641765-70641787 TTCCAAGCACAGATAGTGGAGGG - Intronic
932843882 2:75114918-75114940 TTGTAAACACAGACAGGGAATGG + Intronic
936896372 2:117432506-117432528 CTGTGTCCTCAGATAGTGGAAGG + Intergenic
937626480 2:124049898-124049920 CTGTAATCTCACATGGTGGAGGG + Intronic
940902759 2:159141223-159141245 CTGTAACCTCATGTAGTGGAAGG + Intronic
941264611 2:163344884-163344906 AAGTAAACACAAATAATGGAGGG - Intergenic
941857233 2:170243387-170243409 TTCTAAGCACAGATAGAGGAAGG + Intronic
945040851 2:205742806-205742828 CTGTAAGCACAAATAGTTAATGG + Intronic
945139864 2:206673378-206673400 CTGTAATCCCAGCTACTGGAGGG - Intronic
945271935 2:207949416-207949438 CTGTAATCCCAGCTACTGGAAGG + Intronic
948414933 2:237796259-237796281 CTGTAATCCCAGCTACTGGAAGG + Intronic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1168871195 20:1130124-1130146 TTGTAGAGACAGACAGTGGATGG + Intronic
1169720558 20:8671807-8671829 ATGGAAAGACAGATAGTGGTGGG - Intronic
1172168399 20:32913308-32913330 CTGTAAACTTACATGGTGGAAGG + Intronic
1172545363 20:35756789-35756811 CTGTAATCCCAGCTACTGGAGGG - Intergenic
1173480522 20:43395153-43395175 CTGTAATCCCAGATACTTGAGGG + Intergenic
1175083729 20:56442135-56442157 CTGTCAACACAGATATAGAAAGG - Intronic
1175584945 20:60131766-60131788 CTGGAAACAGAGAGAGAGGACGG + Intergenic
1175604026 20:60297847-60297869 CTGTAAACACAGATGAAGCATGG + Intergenic
1176937274 21:14881980-14882002 CTGTATACTCACATGGTGGAAGG + Intergenic
1176943993 21:14956538-14956560 CTGTAATCCCAGCTACTGGAGGG + Intergenic
1177495305 21:21881616-21881638 GTTTCAACACAGATACTGGAAGG + Intergenic
1177904906 21:26963891-26963913 ATGTAAACAAAGATGCTGGAGGG - Intronic
1180614202 22:17117318-17117340 CTGGAAGCACAGATTGTGCATGG + Exonic
1181555500 22:23669326-23669348 CTGTAATCCCAGCTGGTGGAAGG + Intergenic
1182342499 22:29635132-29635154 CTGCAAACACAGAGAAGGGATGG + Intronic
1184393699 22:44220218-44220240 CTGTAATCCCAGCTAGTTGAAGG - Intergenic
949519702 3:4838888-4838910 CTGAAAGGACAGATAGTGTAGGG - Intronic
949809008 3:7985858-7985880 CTGTACACACAGCTAGTAGAGGG - Intergenic
950482352 3:13252230-13252252 TTGTAGAGACAGAAAGTGGAAGG - Intergenic
950664388 3:14486394-14486416 CTGTAAACCCAGCTATTGCAGGG - Exonic
950795884 3:15510583-15510605 CTGTAATCCCAGCTACTGGAAGG + Intronic
951803755 3:26624055-26624077 ATGTAAATACAGATGGGGGAGGG + Intronic
952233810 3:31458456-31458478 CTGTAATCCCAGATACTGGCTGG + Intergenic
953445051 3:42956315-42956337 CTGTGTACTCAGAAAGTGGAAGG + Intronic
956894062 3:73641638-73641660 CTGTGAATTCAGCTAGTGGAAGG - Intergenic
957269061 3:78005032-78005054 CTGGAAAAACAGCCAGTGGATGG + Intergenic
957924273 3:86788607-86788629 CTGTAATCCCAGCTACTGGAGGG - Intergenic
959859360 3:111199349-111199371 CTGTAAACACAGCTACAGAATGG - Intronic
960260108 3:115557658-115557680 CTGTGACCTCACATAGTGGAAGG + Intergenic
962327669 3:134449437-134449459 CAGGAAACACAGAGATTGGAAGG - Intergenic
964065796 3:152577294-152577316 CTGTAATCCCAGCTACTGGAGGG + Intergenic
964692749 3:159470339-159470361 CTGTATACACAGACAGTCAAAGG + Intronic
965191717 3:165538892-165538914 CTGTAATCCCAGAAATTGGAAGG - Intergenic
965448746 3:168809947-168809969 CTGTGAAGACAGAAAGGGGAAGG - Intergenic
967050585 3:185780214-185780236 CTGGAAAGACAGATAATGAAAGG + Intronic
967172477 3:186832763-186832785 CTGTGGTCACAGATAGGGGAAGG + Intergenic
970659069 4:18264251-18264273 CTGGAGACACAGAGAGTGAAGGG + Intergenic
970828879 4:20311319-20311341 CTGTGAACACAAATATTTGAGGG - Intronic
972226265 4:37016435-37016457 CTGTGTACTCACATAGTGGAAGG - Intergenic
974610630 4:64210771-64210793 CTGTAATCCCAGCTAGTGGGAGG - Intergenic
974771045 4:66414064-66414086 CAGGAAACACAGATGCTGGAGGG + Intergenic
976073584 4:81271362-81271384 CTGTAATCCCAGCTAGTTGAGGG + Intergenic
976812247 4:89110326-89110348 CTGTCATGCCAGATAGTGGAAGG + Intronic
977183438 4:93905887-93905909 CTGTAATCCCAGATATTGGTAGG - Intergenic
977626524 4:99194443-99194465 CTGTAATCACAGCTACTCGAGGG - Intergenic
978287475 4:107095464-107095486 CAGAAAACACTGAGAGTGGATGG - Intronic
979752126 4:124291693-124291715 CTATAAACAAATATATTGGAAGG - Intergenic
980959055 4:139456221-139456243 TTGAAAGCAGAGATAGTGGAGGG + Intronic
981229411 4:142335813-142335835 GTGTAACCACTGATAGTGGCAGG + Intronic
981418598 4:144522468-144522490 CTGTAAACCCAGTAAATGGAAGG - Intergenic
981506690 4:145508820-145508842 CTGTAACCTCATATGGTGGAAGG + Intronic
981830133 4:148990081-148990103 GGGTAATCACAGATAGTTGAAGG - Intergenic
983034545 4:162847478-162847500 CAGTGAAGACAGATAGTAGAAGG + Intergenic
984045731 4:174796187-174796209 CTGTAACCTCACATGGTGGAAGG - Intronic
984339387 4:178435866-178435888 CTGTAAGTACAGATATGGGAAGG + Intergenic
985132249 4:186750455-186750477 CAGGAAAACCAGATAGTGGATGG + Intergenic
985864084 5:2498284-2498306 ATGTAATCACAAATAGTGGCCGG + Intergenic
986610408 5:9561471-9561493 AGGTAAGCACAGATATTGGATGG - Intergenic
987746144 5:21974618-21974640 CTGTAAATAGAGATTCTGGAAGG - Intronic
987784665 5:22484510-22484532 CAGTAAACACTGAATGTGGAAGG + Intronic
988104152 5:26721954-26721976 CTGTAACCTCACATGGTGGAAGG + Intergenic
988821230 5:34888129-34888151 CTGTAAACTCACATGGTGGAAGG - Intronic
989243284 5:39224344-39224366 CTGTGAAAACAGATGGGGGAGGG + Intronic
989250432 5:39308065-39308087 CTATAAACACCGATAGCGCATGG - Intronic
990735473 5:58856255-58856277 CTCCAAACAGAGAGAGTGGAGGG + Exonic
991766350 5:69984728-69984750 CTGTAAATAGAGATTCTGGAAGG - Intergenic
991780968 5:70133425-70133447 CTGTAAATAGAGATTCTGGAAGG + Intergenic
991845583 5:70859811-70859833 CTGTAAATAGAGATTCTGGAAGG - Intergenic
991873414 5:71133739-71133761 CTGTAAATAGAGATTCTGGAAGG + Intergenic
992604933 5:78446170-78446192 CTGTACATACAGAAAGAGGAAGG + Intronic
993342041 5:86736701-86736723 CTATAAACACACATATAGGATGG - Intergenic
994044658 5:95294421-95294443 CTGCAAACACTGAGAGTGGTGGG - Intergenic
994370207 5:98959046-98959068 CTGTAATCTCAGATACTGGGAGG + Intergenic
996294542 5:121896105-121896127 CTCAAAACACAGATAAGGGAAGG + Intergenic
997464484 5:134078250-134078272 CTGCACACACAGACAGAGGAGGG + Intergenic
999902976 5:156106765-156106787 CTGTATACACAGATATTAGTGGG - Intronic
1001477429 5:172060490-172060512 CTGTATCCTCACATAGTGGAAGG - Intronic
1005339380 6:24829188-24829210 CTGTAATCACAGCTACTGGGTGG + Intronic
1006291871 6:33144102-33144124 CTGTAATCCCAGATACTCGAGGG + Intergenic
1007332629 6:41125230-41125252 CTGTAAACCCAGATACTTGGGGG + Intergenic
1007556046 6:42767437-42767459 CTGCAAACACAGATGATAGATGG + Intronic
1010155086 6:72783181-72783203 CTGTAGAGAGAGATGGTGGAGGG + Intronic
1010724468 6:79317573-79317595 CTGTAATCCCAGATACTTGAGGG - Intergenic
1011627996 6:89298903-89298925 CTGTAACCTCACATAGTGGGTGG - Intronic
1011652173 6:89516597-89516619 CTGTAAACCCAGATACTTGCAGG - Intronic
1011713467 6:90079214-90079236 CTGTAGACACAGATGTTGGAGGG - Intronic
1011861821 6:91767564-91767586 CTGAAAACACAGATTGGGGCAGG + Intergenic
1012448250 6:99328366-99328388 CTGTAACCTCATATGGTGGAAGG - Intronic
1012592470 6:100999194-100999216 GTGTGAGCACAGAGAGTGGAAGG + Intergenic
1012634542 6:101520120-101520142 CTGTAAATAATGATAGTGTATGG + Intronic
1013464563 6:110406474-110406496 CTGTAGAAACAGAGAGTAGATGG - Intronic
1013475808 6:110506311-110506333 CTGGAAACAGAGATGGAGGAAGG - Intergenic
1014571071 6:123008743-123008765 CTATAAACACAGGCATTGGAAGG - Intronic
1016732408 6:147440746-147440768 CTCTAATCTCACATAGTGGAAGG + Intergenic
1017048330 6:150367799-150367821 CTGTAACCTCACACAGTGGATGG - Intergenic
1017687668 6:156929326-156929348 ATCTACACACAGAAAGTGGAGGG + Intronic
1018183837 6:161247724-161247746 CTGTAATCACAGATTTTGGGAGG + Intronic
1019944991 7:4320575-4320597 CTGTAGAGACAGAAAATGGAAGG - Intergenic
1022700142 7:32752706-32752728 CTCTAAAAACAGAGATTGGATGG + Intergenic
1023385001 7:39647735-39647757 CTGTAACCTCACATGGTGGAAGG - Intronic
1023751325 7:43375768-43375790 CTGTAATCCCAGCTACTGGAGGG + Intronic
1023796025 7:43792956-43792978 CTGTAAACACAGATAGTGGAGGG + Intronic
1024062605 7:45710148-45710170 CTGTAATCACAGATATTGAAAGG + Intronic
1024395997 7:48867508-48867530 ATGTAAACACACACATTGGATGG - Intergenic
1028423348 7:90658359-90658381 CTGTATACTCAGATGGTAGAAGG + Intronic
1028662432 7:93295289-93295311 CTGTATCCTCAAATAGTGGAAGG + Intronic
1029602717 7:101578557-101578579 CTGTAGTCCCAGATACTGGAAGG + Intergenic
1029972431 7:104802369-104802391 CTGTAATCCCAGATACTGGTGGG + Intronic
1030190769 7:106808116-106808138 CTGTAATCCCAGATACTTGAGGG - Intergenic
1030574498 7:111268854-111268876 CTGTAATCCCAGGTATTGGAAGG - Intronic
1031079965 7:117248870-117248892 ATGTAAACACAGTGTGTGGAAGG - Intergenic
1032381617 7:131489680-131489702 CTGTAAAAATAAATGGTGGAGGG - Exonic
1034870596 7:154679829-154679851 CTGTACCCTCAGATAATGGATGG + Intronic
1035069359 7:156129962-156129984 CAGCAACCAAAGATAGTGGAAGG - Intergenic
1035749610 8:1987167-1987189 GTGTAAAAACAGAGAGAGGAAGG - Intronic
1035819988 8:2580585-2580607 CTGTAAACCCACATAGGGGAAGG - Intergenic
1036538158 8:9672760-9672782 CCATTAACACAGATAGTTGATGG + Intronic
1037701129 8:21274697-21274719 CTGTTAACACAGGGAGTGGAGGG - Intergenic
1038278634 8:26142816-26142838 CTGTAAGCACAGAGAGGTGAAGG + Intergenic
1038948642 8:32389880-32389902 CTGTAACCCCAGTTATTGGAAGG - Intronic
1039122973 8:34169491-34169513 CTGTAAACAAAGACACTGGGGGG + Intergenic
1039237491 8:35517890-35517912 CTGTAACATCACATAGTGGAAGG + Intronic
1039727498 8:40234765-40234787 CTGCAAACACAGCTAGTAGCTGG + Intergenic
1040493930 8:47949501-47949523 CAGTGAACATATATAGTGGAAGG - Intronic
1041036793 8:53799807-53799829 CTGTAAACTCAGATGGCAGAGGG - Intronic
1041862407 8:62529557-62529579 CTGTAAGCTCATATGGTGGAAGG - Intronic
1042613137 8:70619576-70619598 CAGCAATCACAGATAGAGGAAGG + Intronic
1043641859 8:82463087-82463109 CAGAAAACAAAGATATTGGATGG - Intergenic
1044687700 8:94843657-94843679 CTGTATACACATATGATGGAGGG + Intronic
1049030668 8:140035042-140035064 CTGTATACACAGCTGGAGGAGGG + Intronic
1049144732 8:140990884-140990906 CTGAAAACCCAGAGAATGGACGG + Intronic
1050373560 9:4947464-4947486 CTGTAATCTCAGAAACTGGAAGG - Intergenic
1051320306 9:15896697-15896719 GTGTATACACAGATACTGAAGGG - Intronic
1051942179 9:22521066-22521088 CTATAATCCCAGATATTGGAAGG - Intergenic
1051999624 9:23261577-23261599 CTGTAAACACTCATAGTTCATGG + Intergenic
1052449503 9:28610563-28610585 CTGTGTTCACAGGTAGTGGAAGG - Intronic
1053504874 9:38633643-38633665 GTGTAAATACAAATAGGGGATGG + Intergenic
1054739754 9:68793110-68793132 GTGTATACACATATAGTGTAAGG + Intronic
1057137785 9:92706043-92706065 CTGTAACTTCAGATGGTGGAAGG + Intergenic
1057999741 9:99852837-99852859 CTGGAAAGACAGATGGTGGAGGG - Intronic
1186057090 X:5661289-5661311 CTGTGTCCACACATAGTGGAAGG - Intergenic
1189234753 X:39478358-39478380 CTGTAAACACAGTAAATGTAAGG + Intergenic
1189269379 X:39740201-39740223 TTGTAAACACACAGAGTGGGAGG - Intergenic
1189377518 X:40477084-40477106 CTGTAAACACAGATACACTAGGG - Intergenic
1189612964 X:42756167-42756189 CTGTAAACTCAGCTTGTGGTAGG - Intergenic
1190303391 X:49068914-49068936 CTGTAAACATAAATGGAGGAAGG - Intronic
1195267362 X:103195831-103195853 CTTTAAAAATAGATAGTGGCCGG + Intergenic
1195811427 X:108835909-108835931 CTGGAAATGGAGATAGTGGATGG - Intergenic
1197922795 X:131613102-131613124 CTGTAAAAACAGGCAGTGGGGGG - Intergenic
1197928639 X:131672955-131672977 CTGTAATCCCAGCTAGTGGGGGG + Intergenic
1197991445 X:132322490-132322512 ATGTAAGCACACACAGTGGAAGG + Intergenic
1198229371 X:134674805-134674827 CTGTAAAGACAGGAAGAGGAAGG - Intronic
1198521608 X:137458984-137459006 CTGTAATCACAGCTACTGGTTGG + Intergenic
1199585255 X:149408248-149408270 CTGTATCCTCACATAGTGGAAGG - Intergenic
1199973598 X:152878112-152878134 CTCTAAACACTGAAGGTGGAAGG - Intergenic
1200143773 X:153915191-153915213 CTGTAGAGACGGACAGTGGAAGG + Intronic
1201502151 Y:14656698-14656720 CTTAATACACAAATAGTGGATGG - Intronic