ID: 1023797672

View in Genome Browser
Species Human (GRCh38)
Location 7:43807360-43807382
Sequence ATGTTGGGATATTTGGGGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 301}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023797672 Original CRISPR ATGTTGGGATATTTGGGGTT AGG Intergenic
901595551 1:10382715-10382737 ATGTTGGGTTTTTTTGGGTGGGG + Intergenic
904899068 1:33842027-33842049 ATGTTGGGATGTCAGGGATTGGG - Intronic
906652522 1:47522891-47522913 ATGTGAGGATATTTGGAGGTGGG - Intergenic
906670891 1:47653832-47653854 ATTTTGAGGTACTTGGGGTTAGG + Intergenic
908207039 1:61860914-61860936 ATTTTGGGATATGTAGCGTTTGG + Intronic
908972186 1:69850048-69850070 ATGTTGGGTGATTTGGGGTGGGG + Intronic
909030058 1:70528988-70529010 GTGGTGGGAAATGTGGGGTTGGG - Intergenic
910386804 1:86692833-86692855 ACGTGGGGATATGTGGGGGTAGG + Intergenic
910538760 1:88330872-88330894 ATTTTGGGATTACTGGGGTTAGG - Intergenic
911203876 1:95073538-95073560 ATGTTGGGAGACAGGGGGTTTGG - Intergenic
911437540 1:97881142-97881164 ATTTTGAGATAGTGGGGGTTAGG - Intronic
912171184 1:107101351-107101373 ATAGTTGGATATTTGGAGTTAGG + Intergenic
912579929 1:110711383-110711405 ATGTTGAAGTTTTTGGGGTTAGG + Intergenic
913046592 1:115078467-115078489 GTGTGAGGATATGTGGGGTTGGG + Intronic
913446526 1:118956117-118956139 GTGGTGGAAGATTTGGGGTTTGG - Intronic
916149297 1:161770635-161770657 ATATAGTAATATTTGGGGTTAGG + Intronic
916286608 1:163112298-163112320 GTGTTTGGATTTTTGGGGTTAGG - Intronic
917143124 1:171857786-171857808 ATATCGTTATATTTGGGGTTTGG - Intronic
918105919 1:181415211-181415233 ATTGTGGGATTTTTTGGGTTAGG - Intronic
918511832 1:185320767-185320789 ATTTTGAGATACTGGGGGTTAGG + Intergenic
919038273 1:192345452-192345474 ATGTGTCAATATTTGGGGTTTGG + Intronic
920719559 1:208374595-208374617 ATGCTGAGATGTGTGGGGTTGGG + Intergenic
921208997 1:212876183-212876205 ACATTGGGACCTTTGGGGTTTGG - Intronic
921458740 1:215403903-215403925 GTTTTGAGATATTAGGGGTTAGG + Intergenic
921670446 1:217918644-217918666 CTGATGGGATGTTTTGGGTTGGG + Intergenic
922033663 1:221827532-221827554 ATCTTGGGAGATTTGGGGGGGGG + Intergenic
922303898 1:224327577-224327599 ATAATGAGATATTTGGGGATGGG - Intronic
922885735 1:229019120-229019142 ATGTGATGATATTTGGAGTTGGG - Intergenic
922979224 1:229811384-229811406 ATTTTGGATTATTTGGGGTGGGG + Intergenic
923032425 1:230260132-230260154 ATGTTAGGACATTTTGGATTAGG + Intronic
923069387 1:230548946-230548968 ATATTGGGATTTTCTGGGTTGGG + Intergenic
923556714 1:235006790-235006812 ATGTTGGGTTGCTTGGGGGTGGG + Intergenic
923586066 1:235272241-235272263 ATGTTGGTATATTTGGGAAAAGG - Intronic
924244107 1:242064660-242064682 ATGTTTATATATTAGGGGTTTGG - Intergenic
924379593 1:243449983-243450005 AGGGTGGGATTTTTGAGGTTGGG + Intronic
924401203 1:243684304-243684326 ATGTTGAGAGATTGGGGGCTAGG - Intronic
1063237564 10:4134239-4134261 ATGTTGGGTTTTGAGGGGTTGGG + Intergenic
1063571917 10:7223063-7223085 ATGCTGAGGTATTGGGGGTTAGG + Intronic
1063604023 10:7507357-7507379 ATGTTGGGGGATTTGGGATGGGG + Intergenic
1064582518 10:16808741-16808763 ATGTTGAGGTATTTGGGATTGGG - Intronic
1064604422 10:17023987-17024009 GAGTTGAGATATTTGGGGGTAGG - Intronic
1065015290 10:21457162-21457184 ATTTTGAGGTATTGGGGGTTAGG + Intergenic
1066270845 10:33821191-33821213 GTGTTGGGACTTTTGGAGTTTGG + Intergenic
1066572870 10:36792259-36792281 ACGTTAAGATATTTGGGGATTGG + Intergenic
1067219923 10:44336616-44336638 ATGCTGAGGTATTGGGGGTTAGG - Intergenic
1067408854 10:46047334-46047356 ATTCTGGGATATTGGGGGTTAGG + Intergenic
1067968281 10:50939938-50939960 ATGTGGTGATATTTGGAGCTGGG + Intergenic
1068663515 10:59648043-59648065 ATCTTAGGACATTTGGGGTCTGG - Intergenic
1068825778 10:61437258-61437280 ATATTGTCACATTTGGGGTTAGG + Intronic
1069963882 10:72097533-72097555 TTGTTGGGATTGTTGTGGTTTGG - Intronic
1071237016 10:83660971-83660993 ATTCTGAGATACTTGGGGTTAGG - Intergenic
1072295632 10:94007030-94007052 CTGATTGGATATTTGGGGGTGGG + Intronic
1072297596 10:94026301-94026323 ATCTTGAGATATTTGGGGATAGG - Intronic
1073682572 10:105720003-105720025 ATGTGATGATATTTGGGGGTGGG - Intergenic
1074221939 10:111446516-111446538 ATTTTGGAATATTTTGGCTTTGG - Intergenic
1076762504 10:132612409-132612431 ATGTTGTGTTTTGTGGGGTTTGG + Intronic
1079253950 11:18810320-18810342 ATGCTGGGATCTTTGGTGTCAGG - Intergenic
1080604773 11:33855905-33855927 ATTTGGGGATATTTGAGTTTAGG - Intergenic
1080984098 11:37441153-37441175 ATATTGGGAAATGTGTGGTTGGG + Intergenic
1081394490 11:42569591-42569613 ATGTTGGGAGATGGGGGTTTTGG - Intergenic
1082126740 11:48440906-48440928 CTGTTGGGGGATTGGGGGTTAGG + Intergenic
1082858160 11:57828054-57828076 ATATTTGGATCTTTGGGGTCTGG + Intergenic
1083504788 11:63145982-63146004 ATTTTGAGGTATTAGGGGTTGGG + Intronic
1084974319 11:72788171-72788193 ACGCTGGGACATTTGGGGTAGGG + Intronic
1085254213 11:75163385-75163407 AGGTTGCGATGTTTGGGGTGGGG + Intronic
1085685461 11:78618266-78618288 ATGTTGGATTATTTGGTTTTTGG + Intergenic
1085817993 11:79761737-79761759 ATGATGGAAAATTTGGTGTTTGG - Intergenic
1086472858 11:87134366-87134388 ATTCTGAGATATTGGGGGTTAGG + Intronic
1087551592 11:99657339-99657361 ATTTTGGGAATTTGGGGGTTTGG + Intronic
1088324924 11:108592227-108592249 ATGAAGGAATATTTGAGGTTGGG - Intronic
1089853632 11:121521391-121521413 ATCCTGGGATAGTTGGGGCTTGG + Intronic
1090989199 11:131801018-131801040 ATGTTGGGGCATTTGGGGCTGGG + Intronic
1090991911 11:131825339-131825361 ATTCTGAGATATTAGGGGTTAGG + Intronic
1091166220 11:133478513-133478535 CAGGTGGTATATTTGGGGTTGGG - Intronic
1091257673 11:134204577-134204599 ATGTTGGGGGATGTGGGGTAGGG + Intronic
1091827104 12:3521057-3521079 ACCTTGGGATATCTGGGATTAGG - Intronic
1092487628 12:8915545-8915567 ATGTGGGCATACATGGGGTTGGG - Intronic
1092873599 12:12829269-12829291 ATCTTTGTATATTTGGAGTTGGG + Intronic
1093227627 12:16504561-16504583 ATATTAGGGTATTGGGGGTTGGG - Intronic
1094821839 12:34232086-34232108 ATCTTGAAATATTTGAGGTTAGG + Intergenic
1095135865 12:38602245-38602267 ATGAAGGAATATTTGGGGTGAGG + Intergenic
1096447085 12:51703206-51703228 CCTTTTGGATATTTGGGGTTAGG + Intronic
1096912466 12:54998101-54998123 GTGTTGGGATGTTGGGTGTTGGG - Intergenic
1097010586 12:55951005-55951027 ACTTTGGGATGTTTGGGGTATGG + Intronic
1098308010 12:69120688-69120710 ATTCTGAGATATTAGGGGTTAGG + Intergenic
1099854972 12:88152390-88152412 ATGTTTGGGTCATTGGGGTTGGG - Intronic
1100475173 12:94928906-94928928 ATGTTGGGAAATTTGAGTGTGGG + Intronic
1100554877 12:95683567-95683589 ATGGTGGGATACTGGGGCTTCGG - Exonic
1100704999 12:97190955-97190977 TTGTTTGGACATTTTGGGTTAGG - Intergenic
1101064798 12:101009097-101009119 ATTCTGAGATATTGGGGGTTAGG - Intronic
1102476037 12:113189151-113189173 GTGTAGAGACATTTGGGGTTAGG + Intronic
1104434101 12:128742251-128742273 ATTCTGAGATATTGGGGGTTAGG - Intergenic
1106900070 13:34346403-34346425 GTGTTGGGATATTTGTGGTTTGG - Intergenic
1108253157 13:48586956-48586978 AGGTTAGCATATTTGGGGTGAGG + Intergenic
1108322370 13:49301401-49301423 CTGTTGGGTTCTATGGGGTTTGG + Intergenic
1110428998 13:75401295-75401317 ATTGTGGGAGATTTGGGGTTTGG - Intronic
1113606876 13:111614537-111614559 ATGTTGGCATATATAGGTTTAGG + Intronic
1114336491 14:21696744-21696766 TTGTTTGTCTATTTGGGGTTGGG - Intergenic
1114965173 14:27950130-27950152 ATTCTGGGATAGTAGGGGTTAGG - Intergenic
1115167972 14:30471112-30471134 ATGATCAGATATTGGGGGTTGGG - Intergenic
1117423017 14:55566341-55566363 ATTTTGGGGTACTAGGGGTTAGG - Intronic
1118412025 14:65490190-65490212 AATTTGGGTTATTTGGGGTGGGG - Intronic
1118791243 14:69094941-69094963 ATTTTGGAATTTGTGGGGTTGGG + Intronic
1120609604 14:86623904-86623926 ATGTTGGCCTCTTTGGGTTTTGG - Intergenic
1122022497 14:98850794-98850816 ATTTTGAGATACTAGGGGTTAGG - Intergenic
1124380017 15:29157190-29157212 ATGGTTGGAAATTTGGGGCTGGG + Intronic
1124431381 15:29611603-29611625 ATGCTGGGATATTGGTGGTGTGG - Intergenic
1124711762 15:32018721-32018743 ATGTTGTGTTTTTTGTGGTTGGG - Intergenic
1124887863 15:33703619-33703641 ATTCTGGGATATTGAGGGTTAGG + Intronic
1124922620 15:34041085-34041107 ATGTTGGCAAATTTAGGGCTGGG + Intronic
1125192635 15:37011137-37011159 ATGTAAGTATATTTTGGGTTAGG + Intronic
1125961019 15:43830034-43830056 ATGTTGGGATGTTTGTGGGGTGG + Intronic
1126564615 15:50082026-50082048 ATTGTGGGTTTTTTGGGGTTGGG + Intronic
1126865808 15:52935482-52935504 ATATAGTCATATTTGGGGTTAGG + Intergenic
1127849180 15:62897998-62898020 ATGTTGGGAGCTTTGGAGTGAGG - Intergenic
1128059263 15:64724170-64724192 ATGTTGGGAGATCTGGTATTTGG - Intergenic
1128059272 15:64724241-64724263 ATGTTGGGAGATCTGGTATTTGG - Intergenic
1128059293 15:64724404-64724426 ATGTTGGGAGATCTGGTATTTGG - Intergenic
1128059302 15:64724475-64724497 ATGTTGGGAGATCTGGTATTTGG - Intergenic
1131545957 15:93315604-93315626 ATTTTGAGGTATTGGGGGTTAGG + Intergenic
1137866117 16:51898445-51898467 ATCTTGGGATATATGGGGCTTGG + Intergenic
1139076200 16:63451927-63451949 ATTTTGAAACATTTGGGGTTTGG - Intergenic
1139308654 16:66009545-66009567 ATGTTGGGATTGTGGGAGTTTGG + Intergenic
1140865062 16:79052952-79052974 ATGTTTGTGTATTTGGGGGTTGG + Intronic
1142183388 16:88682514-88682536 CTGTTGGGAGATTTTGGCTTTGG - Intronic
1143277626 17:5723506-5723528 ATGTGATGATATTTGGGGATGGG - Intergenic
1145901962 17:28495394-28495416 TTCTTGGGAAATTTGGGGCTTGG - Intronic
1147503760 17:40993128-40993150 ATTTTGTCATATTTGGTGTTTGG + Intergenic
1147541809 17:41366439-41366461 GTATTGGGATATTGGGGGCTGGG + Intronic
1148759164 17:49990594-49990616 CTCTTTGGAGATTTGGGGTTTGG + Exonic
1151127606 17:71861905-71861927 ATTTTTGAATTTTTGGGGTTGGG - Intergenic
1151512913 17:74572456-74572478 ATGTTGGTAGATTTGGTGTTTGG - Intergenic
1152219911 17:79057942-79057964 ATGGTGGGATGTGTTGGGTTTGG - Intergenic
1153711120 18:7800024-7800046 ATTGTGGGATATTTGGATTTGGG + Intronic
1153834995 18:8955750-8955772 ATGTTGGAATATCTGGGATCTGG - Intergenic
1155131594 18:22940180-22940202 ATGTTGGGATTTTGGGATTTGGG + Intronic
1156036855 18:32773656-32773678 CTGTTTTGGTATTTGGGGTTTGG + Exonic
1156889020 18:42168402-42168424 ATTCTGGGATACTAGGGGTTAGG + Intergenic
1157293493 18:46425901-46425923 GTGTTGGGAGATTTGGTGTCTGG + Intronic
1157772128 18:50358485-50358507 ATTTTGAGGTATTGGGGGTTAGG + Intergenic
1157862075 18:51150801-51150823 ATGCTGAGGTATTGGGGGTTAGG - Intergenic
1157866094 18:51185992-51186014 ATGTTGGGAGATTAGTGGTTTGG + Intronic
1159124560 18:64208093-64208115 ATGGGGAGATCTTTGGGGTTGGG - Intergenic
1160303132 18:77704668-77704690 ATATTAGGGTATTTGGGGTAGGG - Intergenic
1163066972 19:14804240-14804262 AGGTTGGGAGATTTTGGTTTTGG + Intronic
1165637034 19:37349261-37349283 CTTTTGAGATATTAGGGGTTTGG + Intronic
927840689 2:26441261-26441283 ATAATAGGCTATTTGGGGTTTGG - Intronic
928923290 2:36548962-36548984 CTGTAGAGATATTTGGGGTGGGG + Exonic
928981514 2:37140322-37140344 ATGTAAGGACATTTGTGGTTAGG + Intronic
929145948 2:38707143-38707165 ATCTTGAAATATTTGAGGTTAGG + Intronic
929859059 2:45660126-45660148 CTGTTGGTAGATATGGGGTTTGG + Intronic
930237419 2:48901430-48901452 ATGTCGGGATCTTAGGGTTTAGG - Intergenic
930480027 2:51936439-51936461 ATGTTGGGATATTTCCTCTTAGG - Intergenic
930809453 2:55525448-55525470 ATGTTTTGTTTTTTGGGGTTGGG - Intronic
933224708 2:79733892-79733914 ATGTTGGGATAATGGGAATTTGG + Intronic
933493633 2:83020056-83020078 ATGTGGCTATATTTGGAGTTAGG - Intergenic
935569721 2:104646456-104646478 TTGTGGGGATATTTGAGGGTGGG - Intergenic
939773710 2:146358156-146358178 ATGGTTGGCTATTTGGAGTTGGG - Intergenic
940358538 2:152771617-152771639 ATTTTGGTATCTGTGGGGTTGGG - Intergenic
941548650 2:166886562-166886584 CTGTTGGCACATTTGGGGTTTGG - Intergenic
947020873 2:225674246-225674268 AGGTTGTGGTATTTGGAGTTGGG + Intergenic
1171543338 20:25983016-25983038 ATCCTGGGATATTTGGTTTTTGG + Intergenic
1173726453 20:45301543-45301565 AGGTCAGGATTTTTGGGGTTGGG - Intronic
1174080398 20:47967265-47967287 GTGCTGGGAGATTTGGGGTCAGG + Intergenic
1174125132 20:48298764-48298786 AGGATGGGAGAATTGGGGTTGGG + Intergenic
1175193109 20:57224554-57224576 AGGTGAGGATATTTGGGGTAGGG - Intronic
1177524573 21:22274993-22275015 ATGGCTAGATATTTGGGGTTTGG + Intergenic
1177732024 21:25039662-25039684 AAGATGAGATACTTGGGGTTTGG - Intergenic
1177923548 21:27184877-27184899 ATGCTGGCAGATTTGGTGTTTGG + Intergenic
1178622402 21:34188076-34188098 AGTGTGAGATATTTGGGGTTTGG - Intergenic
1179272885 21:39865359-39865381 ATTTTGAGATATTGAGGGTTAGG + Intergenic
1179562151 21:42222398-42222420 CTGTTGGCTTATTTGGGGATGGG + Intronic
1181550478 22:23636318-23636340 AAGTCAGGATATTTGGGGTATGG + Intergenic
1181797800 22:25322373-25322395 AAGTCAGGATATTTGGGGTATGG - Intergenic
1185211285 22:49571927-49571949 ATGGTGGGATTTTAGGGGATGGG - Intronic
1185326647 22:50228876-50228898 ATGATGGGGCATTTGGGTTTGGG - Intronic
951931435 3:27971631-27971653 ATGTTTGGATTTCGGGGGTTGGG - Intergenic
952135588 3:30415651-30415673 ATATAGTCATATTTGGGGTTGGG - Intergenic
952311944 3:32198519-32198541 TTATTGGTTTATTTGGGGTTGGG - Intergenic
952581427 3:34837917-34837939 AAGGTGGGACATTTGGGGATAGG - Intergenic
957787147 3:84897758-84897780 ATGATGGTAGATTTGTGGTTTGG + Intergenic
957843643 3:85702228-85702250 TTGTTAGGAGATTTGGGGTAAGG - Intronic
959516857 3:107277321-107277343 ATATTGGTATATTTGGATTTAGG - Intergenic
959786521 3:110305280-110305302 TTGGTGGGATATCTGGTGTTTGG + Intergenic
959834829 3:110906077-110906099 CTGTTGGGATATTTGGCTTGAGG - Intergenic
959966727 3:112364096-112364118 ATGTTGAGATACTTGGACTTAGG + Intergenic
960051082 3:113240145-113240167 TTGTTGGGATATATGGCCTTGGG + Intronic
961713384 3:128843598-128843620 AAGTTGGGTTGTTTGGGGTTCGG + Intergenic
962252381 3:133843749-133843771 ATGTAGGCATCTTTGGGGTCAGG + Intronic
962604885 3:137024950-137024972 GTGTTGGGATGTGTTGGGTTTGG + Intergenic
962882719 3:139593521-139593543 ATGTTGGAATAGGTGGGGTGTGG - Intronic
962923734 3:139973456-139973478 ATGTTAGGAACTTGGGGGTTGGG + Intronic
963387015 3:144610464-144610486 ATGTTATGATATTTGGAGGTGGG - Intergenic
963404735 3:144848374-144848396 ATGTTAGGATATTTGGAGGTAGG + Intergenic
964843004 3:161014843-161014865 GGTTTGGGATATTTGGGGATGGG + Intronic
966239703 3:177742897-177742919 ATTTTGGGATATTTGGTATGTGG + Intergenic
966421062 3:179734692-179734714 AGCTTAGGAGATTTGGGGTTTGG + Intronic
966444787 3:179989939-179989961 ATGTTGGGAAATATGTGGTAAGG - Intronic
966756411 3:183375703-183375725 ATGGCAGGATACTTGGGGTTGGG - Intronic
967039655 3:185679387-185679409 AATTTGTGATATTTGGGGATGGG - Intronic
967067390 3:185931109-185931131 TTGTTTGGATTTTGGGGGTTTGG + Intronic
968906154 4:3451832-3451854 ATGCTGGGCTATTAGGGGTTAGG - Intergenic
969683272 4:8655233-8655255 ATTCTGGGATACTGGGGGTTAGG + Intergenic
969911997 4:10456389-10456411 ATCTTGGTGTCTTTGGGGTTTGG - Intronic
970190708 4:13513733-13513755 ATGTTGAGAGATCTGGGCTTTGG + Intergenic
971928105 4:33041172-33041194 ATGTTGGAATTTATGGGTTTTGG - Intergenic
972130880 4:35831913-35831935 ATTTTGGGATAGTTGTGGTGTGG - Intergenic
972361480 4:38329477-38329499 ATTTAGGGTTATGTGGGGTTGGG - Intergenic
972422544 4:38902706-38902728 TTTTGGGGATACTTGGGGTTTGG + Intronic
972961357 4:44456714-44456736 ATTTTGTGATTTTTTGGGTTAGG - Intergenic
974412633 4:61562012-61562034 ATTTTGAGATATTGAGGGTTTGG + Intronic
974455309 4:62123154-62123176 CTGTTGGGGGTTTTGGGGTTAGG - Intergenic
974835578 4:67245670-67245692 ATTTAGGGAGTTTTGGGGTTTGG - Intergenic
975123978 4:70761154-70761176 AATTTGGTATATTTGGTGTTTGG + Intronic
975524733 4:75336448-75336470 ATGGTGGGATAAATGGTGTTGGG + Intergenic
976702834 4:87989861-87989883 ATTCTGAGATATTGGGGGTTAGG - Intergenic
977419392 4:96778793-96778815 ATTCTGAGATATTGGGGGTTAGG - Intergenic
978164702 4:105592807-105592829 AAGTTGGTAGATTTGGTGTTGGG - Intronic
979118764 4:116865580-116865602 ATTTTTGGATATTTGTGATTAGG + Intergenic
979147532 4:117263945-117263967 ATCTAGAGGTATTTGGGGTTTGG - Intergenic
979564968 4:122145042-122145064 GTGTTGAGATACTTGGGATTAGG + Intergenic
979608158 4:122661374-122661396 ATCTGGGGTTATTTGGGGTGTGG - Intergenic
979632021 4:122913581-122913603 ATATTGAGATATTTGAGATTTGG - Intronic
980135351 4:128853299-128853321 ATTTTGAGATATTTGGAGTTAGG + Intronic
980996698 4:139785975-139785997 ATTCTGAGATATTGGGGGTTAGG - Intronic
981949799 4:150392507-150392529 ATGTGAGGATATTTGGAGATGGG - Intronic
982237450 4:153264821-153264843 ATCTGGGGATCTTTGGGGATTGG + Intronic
982446114 4:155492360-155492382 ATTCTGAGGTATTTGGGGTTAGG - Intergenic
983576223 4:169264391-169264413 ATGTGGCCATATTTGGGGATAGG - Intronic
985524500 5:395136-395158 GTCTTGGGCTATCTGGGGTTAGG - Intronic
988399422 5:30742439-30742461 ATTTTGAGATATTGGGGGTCAGG + Intergenic
990102399 5:52207956-52207978 ATTCTGAGATATTTGGGGTTAGG + Intergenic
990322743 5:54645988-54646010 ATTTTTGGATACTTGTGGTTTGG + Intergenic
991538126 5:67695807-67695829 ATTATGGGATACTTGGGATTAGG + Intergenic
992415590 5:76549857-76549879 ATTTTGAGGTATTAGGGGTTAGG + Intronic
993140841 5:84031190-84031212 ATTCTGAGATAGTTGGGGTTAGG + Intronic
994121531 5:96119340-96119362 ATGCTGGAAACTTTGGGGTTTGG - Intergenic
994368574 5:98944466-98944488 ATATTGGGATAATTGAGGTATGG + Intergenic
995128792 5:108608129-108608151 ATGTTGTCACATTTTGGGTTAGG - Intergenic
1001545065 5:172565946-172565968 ATTTAGGGATACTGGGGGTTAGG + Intergenic
1001716854 5:173823584-173823606 ATGTGGTGATATTTGGAGATGGG - Intergenic
1001801146 5:174545297-174545319 ATTTTGAGATACTAGGGGTTAGG - Intergenic
1005360698 6:25028280-25028302 ATGTTTTGAGATTTGGGGATAGG + Intronic
1006205262 6:32335813-32335835 ATGTTGGGATTTCAAGGGTTTGG - Intronic
1007068294 6:39015103-39015125 ATGTTGGCAGACTTGGAGTTGGG + Intronic
1007939899 6:45770592-45770614 ATTCTGAGATATTAGGGGTTAGG + Intergenic
1008523795 6:52387656-52387678 ATGTAAGGATATTAGGGGGTGGG + Intronic
1009562707 6:65269864-65269886 ATGTAAGGATATTTGGAGGTAGG - Intronic
1009816599 6:68744731-68744753 CTGTTGGGGGATATGGGGTTAGG + Intronic
1010296816 6:74208006-74208028 ATGTGGGGAGACTTAGGGTTGGG + Intergenic
1010648602 6:78424363-78424385 ATGTGGGGATATGTGGGGGGTGG + Intergenic
1011771765 6:90681143-90681165 ATTCTGAGATATTGGGGGTTAGG + Intergenic
1012272583 6:97232862-97232884 AATTTGGGATGTTTTGGGTTTGG - Intronic
1012274945 6:97261745-97261767 ATGTAGGGAGATGTGGGTTTAGG + Intronic
1013975972 6:116079033-116079055 CTTTTGGGTTATTTGCGGTTTGG + Intergenic
1015820470 6:137255053-137255075 ATGTTGAAATATTGGGGGTGGGG + Intergenic
1015903062 6:138087482-138087504 ATGTGGGGATATATGGAGTGGGG + Intergenic
1015956213 6:138600811-138600833 ATGTTGAAATATTGGAGGTTAGG - Intronic
1016777807 6:147924111-147924133 ATTTTGGTATATATGGGGATGGG + Intergenic
1016915525 6:149240896-149240918 ATATTGTCACATTTGGGGTTAGG - Intronic
1019072021 6:169354660-169354682 ATGTTGAAATATTGGGGGCTGGG - Intergenic
1020106857 7:5426218-5426240 ATCTTGAGAGATTTGGGGTGGGG + Intergenic
1020952108 7:14692962-14692984 ATGTTGGCACATATGGGTTTAGG - Intronic
1020987909 7:15158949-15158971 ATGTTGCTATTTTTGGGGTTGGG + Intergenic
1021587380 7:22223737-22223759 ACGTTGGCATATTTGGTGGTAGG + Intronic
1022866319 7:34425260-34425282 ATTCTGGGATATGGGGGGTTAGG + Intergenic
1023225880 7:37968450-37968472 ATCTTGGGAGATTTTGGTTTAGG + Intronic
1023797672 7:43807360-43807382 ATGTTGGGATATTTGGGGTTAGG + Intergenic
1024153578 7:46597939-46597961 ATCTTGGGATATTTGGGGATGGG - Intergenic
1027857935 7:83536902-83536924 ATATAGTGATATTTGGGGTTAGG - Intronic
1029020198 7:97357157-97357179 CTGTTGGGAGATTCAGGGTTGGG - Intergenic
1033045997 7:137962572-137962594 ATGTTGTGATATTTGAGTCTGGG - Intronic
1033894589 7:146054976-146054998 CTTTAGGGATATTTGGGATTAGG + Intergenic
1034984349 7:155498085-155498107 CGGTTGGGATTTTTGCGGTTTGG + Intronic
1036002324 8:4621369-4621391 ATTTTGGAACATTTGGGATTTGG + Intronic
1037050337 8:14364917-14364939 ATTTTGTGACATTTGGGGTGGGG - Intronic
1037121031 8:15287147-15287169 ATGTTGGCATATATGGTGTCTGG - Intergenic
1039861860 8:41466037-41466059 ATGTGAGGATATTTGGAGCTGGG + Intergenic
1040119798 8:43670906-43670928 ATCTGGGAATATTTGGTGTTTGG - Intergenic
1041524609 8:58791193-58791215 ACTTCGGGTTATTTGGGGTTGGG - Intergenic
1043271931 8:78344966-78344988 ATGTCAGGATATTTAGGGGTGGG + Intergenic
1043649734 8:82576485-82576507 AAGTTGTCATATTTGGTGTTTGG + Intergenic
1043788650 8:84434303-84434325 ATTTTGAGATATCGGGGGTTAGG + Intronic
1044495841 8:92881278-92881300 ATGTTGGGATTTTTGTTGGTTGG - Intergenic
1044674847 8:94718960-94718982 AAGTTAGGATATTTGGGGAGAGG - Intergenic
1045557580 8:103229561-103229583 ATGTTGAGGGATTTGGGGTCTGG + Exonic
1047323027 8:123806977-123806999 ATATTGGCATATATGTGGTTTGG + Intronic
1048049549 8:130804463-130804485 ATTTTGAGATCCTTGGGGTTAGG + Intronic
1048388797 8:133940310-133940332 ATGTTACCATATTTGGAGTTAGG - Intergenic
1048698225 8:137053031-137053053 TTGTTTGGAAATTTGGGTTTGGG + Intergenic
1051350694 9:16195663-16195685 ATTTTTGGATATTTCTGGTTGGG - Intergenic
1051611832 9:18968887-18968909 AAGTAGGGATATTTTTGGTTGGG - Intronic
1051903151 9:22064386-22064408 ATGTTGGGCTTATTGGGGATGGG + Intergenic
1052012486 9:23426904-23426926 ATGTTGCGTTTTTTGGGGGTGGG + Intergenic
1052145129 9:25039836-25039858 ATATTGGGAAGTTTGGGGCTGGG - Intergenic
1053151699 9:35747959-35747981 ATGTTGTTTTATTTGGGGGTGGG - Intronic
1053409754 9:37908007-37908029 ATGTTGGGTTTTTTTGAGTTAGG - Intronic
1053561873 9:39204678-39204700 ATGTTGGTATCTTTGGGGGTGGG + Intronic
1053572607 9:39325278-39325300 ATTTTGAGATATTGGGGATTAGG + Intergenic
1053827683 9:42042697-42042719 ACGTTGGTATATTTGGGGGTGGG + Intronic
1054094167 9:60883990-60884012 ATTTTGAGATATTGGGGATTAGG + Intergenic
1054115636 9:61159905-61159927 ATTTTGAGATATTGGGGATTAGG + Intergenic
1054124538 9:61293733-61293755 ATTTTGAGATATTGGGGATTAGG - Intergenic
1054135245 9:61414274-61414296 ATGTTGGTATCTTTGGGGGTGGG - Intergenic
1054592119 9:67022637-67022659 ATTTTGAGATATTGGGGATTAGG - Intergenic
1054602877 9:67144745-67144767 ACGTTGGTATCTTTGGGGGTGGG - Intergenic
1058396669 9:104561403-104561425 AGGTTGGGGTGTTTGGGGGTGGG + Intergenic
1060162347 9:121375939-121375961 ATGCTGAGATATATGGTGTTAGG + Intergenic
1186559910 X:10600453-10600475 ATATTTGGATACTTGGGGGTTGG + Intronic
1187014593 X:15313435-15313457 ATCTTGGTAAATTTGGGGGTGGG + Intronic
1187504512 X:19867948-19867970 ATGTTGTGTTATTTGGAGATGGG - Intronic
1188537274 X:31211393-31211415 ATGTTGGGAATATTGGTGTTTGG - Intronic
1188691663 X:33136714-33136736 ATGTTGGCAGATTTGGTGTCTGG - Intronic
1188839551 X:34999280-34999302 ATGTTAGGATATGTGGGCTGTGG - Intergenic
1190067076 X:47248811-47248833 ATGTGGGCAAATTTGTGGTTTGG + Intergenic
1194263264 X:91724380-91724402 ATGTTGAATTATTTGGGGGTTGG - Intergenic
1195111222 X:101652035-101652057 ATCATGGGATATTTGGGTTGAGG - Intergenic
1195774836 X:108391605-108391627 TTGTTGGGCTCTGTGGGGTTGGG + Intronic
1197092722 X:122557502-122557524 ATTTTGGGCTATTTGGAGTATGG + Intergenic
1197136884 X:123071792-123071814 ATCTTTGGGTCTTTGGGGTTAGG - Intergenic
1199683760 X:150245749-150245771 ATGTATGTACATTTGGGGTTGGG + Intergenic
1199921250 X:152405935-152405957 ATGATGGGCTATCTGGAGTTAGG - Intronic
1199935487 X:152569448-152569470 ATATTGGGGTGTTTGGTGTTTGG + Intergenic
1200021228 X:153211533-153211555 ATGTTGAAATATTGGGGGTGAGG - Intergenic
1201038997 Y:9810375-9810397 AGGTTGAGAGATTTAGGGTTTGG - Intergenic