ID: 1023798112

View in Genome Browser
Species Human (GRCh38)
Location 7:43810710-43810732
Sequence GGCGCGCCTCCTCATGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023798112_1023798118 2 Left 1023798112 7:43810710-43810732 CCTCTCTCATGAGGAGGCGCGCC No data
Right 1023798118 7:43810735-43810757 GCCCCCTTGTGGCAGCCTCAGGG No data
1023798112_1023798117 1 Left 1023798112 7:43810710-43810732 CCTCTCTCATGAGGAGGCGCGCC No data
Right 1023798117 7:43810734-43810756 CGCCCCCTTGTGGCAGCCTCAGG No data
1023798112_1023798120 3 Left 1023798112 7:43810710-43810732 CCTCTCTCATGAGGAGGCGCGCC No data
Right 1023798120 7:43810736-43810758 CCCCCTTGTGGCAGCCTCAGGGG 0: 10
1: 7
2: 14
3: 35
4: 180
1023798112_1023798113 -9 Left 1023798112 7:43810710-43810732 CCTCTCTCATGAGGAGGCGCGCC No data
Right 1023798113 7:43810724-43810746 AGGCGCGCCCCGCCCCCTTGTGG No data
1023798112_1023798124 15 Left 1023798112 7:43810710-43810732 CCTCTCTCATGAGGAGGCGCGCC No data
Right 1023798124 7:43810748-43810770 AGCCTCAGGGGTGAGAAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023798112 Original CRISPR GGCGCGCCTCCTCATGAGAG AGG (reversed) Intergenic
No off target data available for this crispr