ID: 1023800234

View in Genome Browser
Species Human (GRCh38)
Location 7:43827411-43827433
Sequence GGGGAGGGACGACCTCCGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023800234_1023800243 4 Left 1023800234 7:43827411-43827433 CCATTCGGAGGTCGTCCCTCCCC No data
Right 1023800243 7:43827438-43827460 AGAGTGGATCAAAGACAACAGGG No data
1023800234_1023800244 12 Left 1023800234 7:43827411-43827433 CCATTCGGAGGTCGTCCCTCCCC No data
Right 1023800244 7:43827446-43827468 TCAAAGACAACAGGGACCAACGG 0: 11
1: 7
2: 12
3: 27
4: 299
1023800234_1023800245 13 Left 1023800234 7:43827411-43827433 CCATTCGGAGGTCGTCCCTCCCC No data
Right 1023800245 7:43827447-43827469 CAAAGACAACAGGGACCAACGGG 0: 8
1: 14
2: 16
3: 32
4: 214
1023800234_1023800242 3 Left 1023800234 7:43827411-43827433 CCATTCGGAGGTCGTCCCTCCCC No data
Right 1023800242 7:43827437-43827459 TAGAGTGGATCAAAGACAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023800234 Original CRISPR GGGGAGGGACGACCTCCGAA TGG (reversed) Intergenic
No off target data available for this crispr