ID: 1023803325

View in Genome Browser
Species Human (GRCh38)
Location 7:43853606-43853628
Sequence CCTTCTAGGTAGAGGAAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023803325_1023803334 26 Left 1023803325 7:43853606-43853628 CCAACCTTCCTCTACCTAGAAGG No data
Right 1023803334 7:43853655-43853677 CTCAAACTGCAGCTCTTCCCTGG No data
1023803325_1023803331 2 Left 1023803325 7:43853606-43853628 CCAACCTTCCTCTACCTAGAAGG No data
Right 1023803331 7:43853631-43853653 TTCTGCCGGCAGCCTGTTTCTGG No data
1023803325_1023803335 27 Left 1023803325 7:43853606-43853628 CCAACCTTCCTCTACCTAGAAGG No data
Right 1023803335 7:43853656-43853678 TCAAACTGCAGCTCTTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023803325 Original CRISPR CCTTCTAGGTAGAGGAAGGT TGG (reversed) Intergenic
No off target data available for this crispr