ID: 1023803329

View in Genome Browser
Species Human (GRCh38)
Location 7:43853617-43853639
Sequence CTACCTAGAAGGAATTCTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023803324_1023803329 9 Left 1023803324 7:43853585-43853607 CCTGAACATAAAAAAGACTGACC No data
Right 1023803329 7:43853617-43853639 CTACCTAGAAGGAATTCTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023803329 Original CRISPR CTACCTAGAAGGAATTCTGC CGG Intergenic
No off target data available for this crispr