ID: 1023805593

View in Genome Browser
Species Human (GRCh38)
Location 7:43870568-43870590
Sequence CCATGACCACACTGAGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023805587_1023805593 18 Left 1023805587 7:43870527-43870549 CCATGGGAAGGGGAAATGGAAGA 0: 1
1: 0
2: 3
3: 66
4: 482
Right 1023805593 7:43870568-43870590 CCATGACCACACTGAGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023805593 Original CRISPR CCATGACCACACTGAGAAGA GGG Intronic
No off target data available for this crispr