ID: 1023807731

View in Genome Browser
Species Human (GRCh38)
Location 7:43885805-43885827
Sequence GCTGCAGCCACTCACCATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 1, 2: 2, 3: 23, 4: 257}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023807726_1023807731 13 Left 1023807726 7:43885769-43885791 CCTCCCAAGCTGAAGTTCTCCAT 0: 1
1: 0
2: 5
3: 40
4: 273
Right 1023807731 7:43885805-43885827 GCTGCAGCCACTCACCATGCAGG 0: 1
1: 1
2: 2
3: 23
4: 257
1023807723_1023807731 24 Left 1023807723 7:43885758-43885780 CCCCAAGGGAACCTCCCAAGCTG 0: 1
1: 0
2: 1
3: 29
4: 472
Right 1023807731 7:43885805-43885827 GCTGCAGCCACTCACCATGCAGG 0: 1
1: 1
2: 2
3: 23
4: 257
1023807727_1023807731 10 Left 1023807727 7:43885772-43885794 CCCAAGCTGAAGTTCTCCATCTG 0: 1
1: 0
2: 2
3: 25
4: 733
Right 1023807731 7:43885805-43885827 GCTGCAGCCACTCACCATGCAGG 0: 1
1: 1
2: 2
3: 23
4: 257
1023807724_1023807731 23 Left 1023807724 7:43885759-43885781 CCCAAGGGAACCTCCCAAGCTGA 0: 1
1: 0
2: 1
3: 14
4: 120
Right 1023807731 7:43885805-43885827 GCTGCAGCCACTCACCATGCAGG 0: 1
1: 1
2: 2
3: 23
4: 257
1023807728_1023807731 9 Left 1023807728 7:43885773-43885795 CCAAGCTGAAGTTCTCCATCTGC 0: 1
1: 0
2: 0
3: 44
4: 539
Right 1023807731 7:43885805-43885827 GCTGCAGCCACTCACCATGCAGG 0: 1
1: 1
2: 2
3: 23
4: 257
1023807725_1023807731 22 Left 1023807725 7:43885760-43885782 CCAAGGGAACCTCCCAAGCTGAA 0: 1
1: 0
2: 0
3: 15
4: 158
Right 1023807731 7:43885805-43885827 GCTGCAGCCACTCACCATGCAGG 0: 1
1: 1
2: 2
3: 23
4: 257
1023807729_1023807731 -6 Left 1023807729 7:43885788-43885810 CCATCTGCAATGTCCAAGCTGCA 0: 1
1: 0
2: 0
3: 17
4: 215
Right 1023807731 7:43885805-43885827 GCTGCAGCCACTCACCATGCAGG 0: 1
1: 1
2: 2
3: 23
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023807731 Original CRISPR GCTGCAGCCACTCACCATGC AGG Intronic
900097024 1:943964-943986 ACTGCAGCCACCAACCCTGCGGG + Exonic
900160501 1:1221003-1221025 GCCGCAGCCTCCCAGCATGCCGG - Intronic
900416816 1:2539153-2539175 TCTGCAGCAACTCCCCAGGCTGG + Intergenic
900556837 1:3284902-3284924 GGTGCACCTACTCACCACGCTGG + Intronic
901015576 1:6227916-6227938 ACTGCAGCCTCTCAAAATGCTGG - Intronic
901821560 1:11833631-11833653 AGTGCAGACACTCACCATCCTGG - Exonic
902029910 1:13414712-13414734 GCTGCAGCCTCTCAAAGTGCTGG + Intronic
902782603 1:18714338-18714360 GCCTCTGCCACTCACCTTGCAGG + Intronic
902794795 1:18794037-18794059 CCTGCAGCCCCTCAGCTTGCCGG - Intergenic
903664200 1:24996617-24996639 GCTACAGCCACTCCCGCTGCAGG + Intergenic
903846727 1:26283381-26283403 GCTTCAGCCACACATAATGCTGG - Intronic
904013025 1:27400675-27400697 GCTCCAGCCAGTCACAATGCAGG - Intergenic
904318257 1:29680014-29680036 CCTCCACCCACTCACCCTGCAGG - Intergenic
906148410 1:43573512-43573534 CTTGCAGCCCCTCACCCTGCTGG + Intronic
906317915 1:44800153-44800175 CCGGCAGCTAGTCACCATGCAGG - Intergenic
907197452 1:52698206-52698228 GCTGGAGCCGCTCACCGTCCGGG + Exonic
907286926 1:53386682-53386704 CCTGCAGCCTCTCCCCAGGCTGG - Intergenic
908464902 1:64383822-64383844 GCTTCAGCCTCTCAAAATGCTGG + Intergenic
911731978 1:101300960-101300982 GCTTCAGCCTCTCAAAATGCTGG + Intergenic
915343287 1:155187682-155187704 GCTGCAGCCCAGCACCATGCCGG - Intronic
915559948 1:156681340-156681362 GCTGCACCCACTCTCCTTGGTGG - Intergenic
917978522 1:180255127-180255149 GCTGCCGCCTCCCACCAGGCTGG - Intronic
918984661 1:191608608-191608630 GCTGGAGCCAGCCACCTTGCAGG + Intergenic
921058268 1:211561040-211561062 GCTACAGCAAGTCACCAGGCAGG - Intergenic
922051858 1:221998467-221998489 GCTGCAGCCACACACCACATAGG - Intergenic
922871005 1:228901921-228901943 TCTGCAGACACTCAGCAAGCTGG - Intergenic
924627048 1:245704280-245704302 GCCCCAGCCACTCCCCAAGCGGG + Intronic
1063019490 10:2113620-2113642 GCCTCAGCCTCTCAACATGCTGG + Intergenic
1063391564 10:5652991-5653013 GCTGCAGGCTCTCACCCCGCTGG + Exonic
1066498403 10:35965122-35965144 ACCTCAGCCACTCAACATGCTGG + Intergenic
1068332965 10:55597098-55597120 GATGCTGCCACTTACCATGGCGG + Intronic
1068835190 10:61545216-61545238 GCTTCAGCCACCCACAGTGCTGG - Intergenic
1069773841 10:70915540-70915562 TCTGCACCCACTCACCAGGCTGG - Intergenic
1069914907 10:71781497-71781519 GCTGAAGCCCCTCCCCATGAGGG + Intronic
1072216438 10:93291222-93291244 GCTGGGGACACACACCATGCAGG - Intergenic
1073706956 10:105995064-105995086 GAAGCAGCCACTCAGCATTCGGG - Intergenic
1075744595 10:124717963-124717985 GCTCCAGTCACTCAGCAGGCAGG + Intronic
1076102806 10:127796701-127796723 GCTGTAGACACTCAGCATGTGGG + Intergenic
1076126436 10:127977892-127977914 GCTGCAGCCACTCTGCTTCCAGG - Intronic
1076151968 10:128169663-128169685 GCTGCAGCCAGCCTCCACGCAGG - Intergenic
1076496646 10:130901738-130901760 TCTGCAGCCACACACTGTGCAGG - Intergenic
1076583632 10:131531436-131531458 CCTGCAGCCACTGACAATGAAGG + Intergenic
1076847095 10:133074658-133074680 TCTGGAGCCACTGACCACGCGGG - Intronic
1076888081 10:133271672-133271694 GCTGCAGTCACTGAACATCCTGG + Exonic
1077010224 11:376344-376366 GCTGCGGACACTCACCGTCCGGG - Exonic
1077034723 11:489115-489137 GCTGCAGCCACTGCTCAAGCTGG + Intronic
1078248927 11:9601373-9601395 GCTGGGGCCACTCAGCATTCGGG - Intergenic
1079146441 11:17856448-17856470 GCTGCAGCCTGTCTCCATGAAGG - Intronic
1079771752 11:24470826-24470848 GCTTCAGCCTCCCAACATGCTGG + Intergenic
1080976960 11:37354843-37354865 GATGCACACACACACCATGCTGG - Intergenic
1081711537 11:45219660-45219682 CCCGCAGCCACTCCCCAGGCCGG - Exonic
1083487845 11:62994796-62994818 GCAGAGGCCACTCCCCATGCTGG + Intronic
1085450147 11:76626991-76627013 CCTGCTGCCACTCACCAAGGGGG + Intergenic
1085516664 11:77115807-77115829 CCCGCACCCACTCACCAAGCTGG - Intronic
1085736835 11:79046261-79046283 GCAGTTGCCACTCTCCATGCTGG - Intronic
1085769864 11:79315178-79315200 GCTGCAGTAAGTCACCAGGCAGG + Intronic
1085792535 11:79508226-79508248 GCTGCAGCCACAACCCATGGTGG + Intergenic
1086089449 11:82991059-82991081 GGTCCTGCCACTCACCAAGCGGG + Intronic
1088815487 11:113417977-113417999 GCTCTGGCCACTCACCATTCTGG - Intronic
1089053975 11:115569760-115569782 GCTTCAGCCTCTCAAAATGCTGG - Intergenic
1090119996 11:124015969-124015991 CCTGCTCCCACTCATCATGCTGG - Exonic
1090120641 11:124023407-124023429 TCTGCTCCCACTCATCATGCTGG - Exonic
1091820883 12:3474412-3474434 GCTGCAGCCACCCAGCATGCGGG + Intronic
1092570377 12:9715059-9715081 GCTGCAGCTCCTCCTCATGCAGG + Intergenic
1092903309 12:13080002-13080024 TCTGCAGCCACTCACCTCGTAGG - Exonic
1094061377 12:26318149-26318171 GCTGCAGTCATCCCCCATGCTGG + Intergenic
1095939821 12:47718742-47718764 GCTACAGTCACTCAGCTTGCAGG - Intronic
1098031330 12:66257807-66257829 GCTTCAGCCTCTCAAAATGCTGG + Intergenic
1098601564 12:72337339-72337361 GCTTCAGGCACTCACCCTTCTGG + Intronic
1099218838 12:79888090-79888112 GCTACAGCCAGACACTATGCTGG + Intronic
1100971357 12:100074347-100074369 GCCTCAGCCTCTCACCGTGCTGG - Intronic
1102037359 12:109779540-109779562 GCTTCAGCCAATCAGCAGGCAGG - Intergenic
1103316048 12:120056789-120056811 GCTGCAGCCACTCTCCTGCCAGG - Intronic
1103403842 12:120661016-120661038 GCTGCTGCCAATCGCCATGCTGG + Intronic
1103546235 12:121703633-121703655 GTTCCAGCCAATCGCCATGCAGG + Intergenic
1103763701 12:123268002-123268024 GCTGCAGTCAGTGACCAAGCAGG + Intronic
1104447148 12:128843860-128843882 GCTTCAGCCTCTCAAAATGCTGG - Intergenic
1105498590 13:20952204-20952226 GGTGCTGCCACTGAGCATGCGGG + Intergenic
1106038408 13:26066722-26066744 GCTGCAGCCACTTGCCACGTGGG - Intergenic
1106194930 13:27484846-27484868 TCTGCAGCCACACATGATGCTGG + Intergenic
1106406573 13:29479945-29479967 GCTGCAGCTTCTCAACATCCAGG + Intronic
1111243125 13:85501811-85501833 CCAGAAGCCACTCAGCATGCAGG + Intergenic
1111598974 13:90447297-90447319 GCAGCAGCCATTCAGCATGATGG + Intergenic
1112802696 13:103130191-103130213 GATGTAGCCACTCCCCATGTGGG - Intergenic
1113339963 13:109412733-109412755 GCTGCAGCCACTCGCCACGGGGG - Intergenic
1113481091 13:110621778-110621800 GCTGCAGCCTCTCAAAGTGCTGG - Intronic
1113483042 13:110635581-110635603 GCAGCCGCCACTCACCCTGCTGG - Exonic
1117017247 14:51530734-51530756 GCTTCAGCCTCCCAACATGCTGG + Intronic
1118103616 14:62633028-62633050 GCTCCAGCCTCTCAAAATGCTGG - Intergenic
1118836841 14:69484159-69484181 GATGGAGCCCCTCCCCATGCGGG + Intergenic
1118853656 14:69604354-69604376 CCTGCACCCACTAACCCTGCTGG + Intergenic
1119732453 14:76959425-76959447 GCAGCAGCCACGCCTCATGCTGG - Intergenic
1122552731 14:102558775-102558797 CCTGGAGCCACTCAACAGGCAGG - Intergenic
1123992857 15:25696308-25696330 GCTGCAGCAAATCACCAACCAGG + Intronic
1124183108 15:27496787-27496809 GCAGCAGCCACTCACATGGCAGG + Intronic
1125806151 15:42495547-42495569 GCTGGAGCCAATCACGGTGCTGG - Exonic
1129334187 15:74842793-74842815 TCTTCAGCCACTGACCCTGCAGG + Intronic
1129339590 15:74876495-74876517 GCTGCAGCCAAGTACAATGCTGG + Intergenic
1130238285 15:82160186-82160208 GCTGCAGCCAATCACCATGCAGG + Intronic
1131430511 15:92384605-92384627 GCTGCGGGCACTCATCCTGCAGG + Intergenic
1132667926 16:1090421-1090443 GCTGGAGCCACTCCCCAGGCAGG - Exonic
1132681387 16:1143726-1143748 GATGCAGCCACGCAGCATGGAGG + Intergenic
1134211656 16:12282544-12282566 ACTGAAGCCACTCAACAGGCTGG - Intronic
1137586994 16:49669708-49669730 CCTGCACCCCCTCACCATCCAGG + Intronic
1138190856 16:55012934-55012956 GCTGCAGCCCATCACCCTGTAGG + Intergenic
1139326158 16:66154086-66154108 CCTCCAGCCACACACCAAGCAGG + Intergenic
1139530238 16:67539061-67539083 CCTCCCGCCACTCACCAAGCGGG - Exonic
1140093572 16:71856343-71856365 GCTGCTGCCACACACACTGCAGG - Exonic
1141627936 16:85271255-85271277 GCTTCAGCCAGTCACCCTGGTGG - Intergenic
1142028853 16:87828583-87828605 GCTGAGGCTGCTCACCATGCTGG + Intergenic
1142067844 16:88072907-88072929 GCAGCAGCCAACCACCAGGCTGG - Intronic
1142839126 17:2613449-2613471 GCTGCAGCCACCAACACTGCGGG - Intronic
1143146544 17:4780302-4780324 GCCTCAGCCTCTCAACATGCTGG + Intronic
1143615172 17:8045363-8045385 GCTGCTGCCTCTCGCCATCCAGG + Exonic
1146005526 17:29158418-29158440 GCTGCTGCCAAACACCATGCGGG + Intronic
1146507185 17:33415600-33415622 GCAGCAGCCAGTCAGTATGCTGG + Intronic
1147254876 17:39175529-39175551 CCAGCAGCCACCCACCAGGCCGG - Exonic
1147321770 17:39650965-39650987 GCTGCGGCCTGTCACCATGAGGG + Intronic
1147595129 17:41712108-41712130 GCTCCAGCCCCTCACCATGAAGG + Intergenic
1149718559 17:58819396-58819418 GCTTCAGCCTCTCATAATGCTGG + Intronic
1151595698 17:75077035-75077057 GCAGCACCCACTCACCCTCCAGG + Intergenic
1151731388 17:75913687-75913709 TCTGGAGCCACTCACCACTCTGG + Exonic
1151984470 17:77533292-77533314 GCTGCAGCCATTTAAAATGCAGG - Intergenic
1152084852 17:78211755-78211777 GCTGCAGCCCCACAGCATCCAGG - Intergenic
1152344844 17:79745019-79745041 GCCTCAGCCTCTCACCGTGCTGG - Intergenic
1152687177 17:81700470-81700492 CATGTAGGCACTCACCATGCTGG - Exonic
1153368219 18:4284028-4284050 ACTACAGACACACACCATGCCGG - Intronic
1153888058 18:9485184-9485206 GCTTCAGCCTCTCAAAATGCTGG + Intronic
1153927519 18:9847092-9847114 TCTGCACCCACTGACCATGATGG - Intronic
1154040818 18:10854029-10854051 GCTGCCTCCACTCTCTATGCAGG + Intronic
1154140445 18:11818991-11819013 CCTGCTCCCACTCGCCATGCTGG - Intronic
1156648112 18:39191572-39191594 TCTGCAGAAACTGACCATGCTGG - Intergenic
1157299054 18:46466624-46466646 GCTGTACACACTCACCATGCTGG + Intergenic
1157469231 18:47975739-47975761 GCTGCAGCAACTCAACTAGCTGG - Intergenic
1157764392 18:50286007-50286029 TATGCAGCCACTCACCTGGCTGG + Exonic
1160579981 18:79878221-79878243 GAAGCAGCCAGTCACCAGGCAGG - Intronic
1161964655 19:7541368-7541390 GCTGCAGCGAGTCACCTTCCTGG + Exonic
1162935461 19:13979476-13979498 GGTGCAGCCGCTGACCGTGCAGG - Exonic
1163341648 19:16711675-16711697 GCTGCAGCCTCTCAAAGTGCTGG + Intergenic
1163419278 19:17205189-17205211 CCTGCAGCCACCCACCCAGCTGG - Intronic
1164867558 19:31617434-31617456 GCAGCAGCCACACAGCCTGCTGG + Intergenic
1165950859 19:39473323-39473345 CCTGCGGGCACTCACCATCCTGG - Exonic
1166099905 19:40565720-40565742 GCTGCAGCCACTCCCAATGGCGG - Exonic
1166211523 19:41309581-41309603 GCTTCAGCCTCTCAAAATGCTGG - Intronic
1166250767 19:41569550-41569572 CCTGCAGCCCCTCTCCCTGCAGG - Intronic
1166765441 19:45250358-45250380 GGCACAGCCACTCCCCATGCGGG - Intronic
1167289641 19:48617301-48617323 GGACCAGCCACTCACCATCCGGG + Exonic
1167865055 19:52318355-52318377 GCTGCAGCCTCTCAAAGTGCTGG + Intronic
1168215388 19:54921440-54921462 GCTGAAGCCACTCAACCTCCAGG + Intergenic
925341250 2:3138946-3138968 TAGGCAGCCACTCAGCATGCAGG + Intergenic
925342124 2:3145077-3145099 GCTCCAGCCACAGACCATGTGGG - Intergenic
925490012 2:4380963-4380985 GCGGCAGCCATTCAGCAAGCTGG - Intergenic
926276163 2:11404821-11404843 GCTGAAGCCACTGAGCATCCAGG + Intergenic
928593680 2:32841115-32841137 ACTCCATCCACACACCATGCTGG + Intergenic
931276972 2:60752754-60752776 GCTTCAGCCTCTCAAAATGCTGG + Intergenic
932368273 2:71166892-71166914 CCTGCAGACACCCACCATGGAGG + Intergenic
934929621 2:98411055-98411077 GCTGCAGCCTCTCAAAATGCTGG + Intergenic
937974394 2:127573441-127573463 GCTGTTGGCACTCCCCATGCCGG + Intronic
938784592 2:134614602-134614624 ACTGCAGCCTCCCAACATGCTGG - Intronic
941014643 2:160341383-160341405 GCCACAGTCACTCACCCTGCAGG - Intronic
941404531 2:165071898-165071920 GCTTCAGCCTCTCACAGTGCTGG + Intergenic
941463840 2:165801931-165801953 CCTGTAGCCTCTCACCATGTTGG + Intergenic
942954803 2:181761634-181761656 GCCTCAGCCACTCAAAATGCTGG + Intergenic
943245047 2:185436076-185436098 GCTTCAGCCTCTCAAAATGCTGG + Intergenic
945193339 2:207213270-207213292 CCTGCAGCCACTCTCTAGGCAGG + Intergenic
945999614 2:216470402-216470424 GCTTCAGCCTCTCAAAATGCTGG + Intronic
947156240 2:227164806-227164828 GCAGCCCCCACTCACCTTGCTGG - Exonic
947672409 2:231946643-231946665 GCTTCAGCCACTGAGCATGTGGG + Intergenic
1172047102 20:32087889-32087911 GCCTCAGCCTCCCACCATGCTGG + Intronic
1172109691 20:32537692-32537714 GAGGCAGCTACTCACGATGCTGG - Intronic
1173227935 20:41172787-41172809 GCTGCAGCCAAGCACCATGCGGG + Exonic
1173520045 20:43692682-43692704 GCTTCAGCCTCTCAACTTGCTGG - Intronic
1174131876 20:48350781-48350803 GCTGCAAACACTCACCAGCCAGG + Intergenic
1175141956 20:56867314-56867336 CCTGCACACACTCACCATGGTGG + Intergenic
1176898689 21:14414815-14414837 GGTGCATAAACTCACCATGCAGG + Intergenic
1177069616 21:16487187-16487209 GCCTCAGCCTCTCAACATGCTGG + Intergenic
1178408159 21:32342353-32342375 GCTGCTGCCTCCCACCAGGCTGG + Intronic
1178524591 21:33316348-33316370 GCTGCAGCCTCTCAAAATGCTGG + Intergenic
1179503945 21:41827589-41827611 GCTGCAGCCTCTCAAAGTGCTGG + Intronic
1179599998 21:42471165-42471187 GCTGCAGCCTCTCACGTAGCTGG + Intergenic
1180669430 22:17541946-17541968 GCGTCAGCCTTTCACCATGCAGG + Exonic
1180839947 22:18954619-18954641 GCGGCCGGCACTCACCAGGCCGG + Intergenic
1180966129 22:19788819-19788841 GATGCAGCCACTGGCCGTGCTGG - Exonic
1181090555 22:20469596-20469618 ACTCCATCTACTCACCATGCAGG + Intronic
1181369462 22:22404775-22404797 GCTGCAGGCACTCACCCTCCTGG - Intergenic
1183279850 22:36926170-36926192 CCCCCAGCCCCTCACCATGCTGG - Exonic
1184429922 22:44436642-44436664 GCCTCAGCCTCTCACCGTGCTGG + Intergenic
1184991250 22:48171463-48171485 GAGGCAGCTCCTCACCATGCTGG - Intergenic
951800567 3:26591053-26591075 ACTTCAGTCTCTCACCATGCAGG - Intergenic
953631255 3:44619874-44619896 GCTGAAGACACTCTTCATGCTGG + Intronic
953819271 3:46190532-46190554 GCTTCAGCCTCCCAACATGCTGG - Intronic
954125165 3:48523916-48523938 CCTGCAGCTACTCACCATTCTGG + Intronic
954294134 3:49664846-49664868 GCTGCTTGTACTCACCATGCTGG - Exonic
955385484 3:58476037-58476059 GCTTCAGCCTCTCAAAATGCTGG + Intergenic
956868959 3:73397642-73397664 ACTGCAGCCACTCACCAGAAGGG - Intronic
959259208 3:104053221-104053243 CCTGCAGCCACTGAACCTGCAGG - Intergenic
962160200 3:132990786-132990808 GCTGCATCCATGCACTATGCTGG - Intergenic
964353652 3:155828837-155828859 GCTTCAGCCTCTCAAAATGCTGG + Intronic
965482792 3:169240966-169240988 CCTGCAGCTACTCACATTGCTGG - Intronic
967020373 3:185517291-185517313 CCTGCAGGCCCTCACCATGGGGG - Intronic
968235387 3:197027963-197027985 GCTGGAGCCACCCTCCATGGTGG - Intronic
968953496 4:3706681-3706703 GTAGGAGCCACTCCCCATGCTGG + Intergenic
969215109 4:5715469-5715491 GAAGCAGCTACTCATCATGCTGG + Intronic
970375750 4:15455512-15455534 GCTGCAGCCAATCCCCAGGCTGG - Intergenic
975217179 4:71769300-71769322 GCAGCAGCCACTCACTCTGTTGG - Intronic
976461788 4:85320467-85320489 GCTGCATCCAATGACCATGTGGG - Intergenic
977784340 4:101015531-101015553 GCTTCAGCCTCTCAAAATGCTGG + Intergenic
979213763 4:118138084-118138106 GCTGTGGCCCCTCACCATTCGGG + Exonic
983168873 4:164513177-164513199 GCTGCTCCCACTCACCTGGCTGG - Intergenic
983714426 4:170761010-170761032 GCCTCAGCCTCTCACAATGCTGG - Intergenic
985572697 5:658249-658271 GCTGCAGCCAGTGTCCAAGCAGG + Intronic
985886354 5:2682834-2682856 GCAGCAGCCACACACCACGCAGG - Intergenic
985926121 5:3020503-3020525 GCTGCCGGCATTTACCATGCAGG - Intergenic
985953769 5:3244534-3244556 GCTGCTTCCACTCACCAGGAAGG + Intergenic
986758334 5:10857811-10857833 GCTGCAGCCTCGCACTATTCTGG + Intergenic
987568474 5:19624691-19624713 GCTGAATGCACTCCCCATGCTGG + Intronic
988018456 5:25592292-25592314 GCTTCAGCCATTCACACTGCTGG - Intergenic
992428241 5:76680853-76680875 GCTTCAGCCTCCCAACATGCTGG - Intronic
994981673 5:106882672-106882694 AATGCAGCCACTCTCAATGCTGG + Intergenic
995845302 5:116487612-116487634 GCTGCAGCCTCCCAAAATGCTGG - Intronic
998483771 5:142484501-142484523 GCTGCAGCCACAAACCATGAGGG + Intergenic
998799993 5:145859604-145859626 GCTGCAGTCACTCCCACTGCTGG - Intergenic
999754471 5:154653967-154653989 GCTGCAGACCCTGACCCTGCTGG + Intergenic
1000694061 5:164358445-164358467 TCTGCAGCCACACAGTATGCAGG + Intergenic
1003502105 6:6711492-6711514 GATGCATCGTCTCACCATGCTGG + Intergenic
1003521169 6:6859962-6859984 ACTGCAGCCACTGGCCATGCCGG - Intergenic
1004977660 6:20985668-20985690 GCTTCAGCCTCTCAAAATGCTGG - Intronic
1006917632 6:37605159-37605181 CCTGCAGCCCCTCATCATGGTGG + Intergenic
1007610284 6:43144584-43144606 CCTGCAGCCCATCACCACGCTGG + Exonic
1008325057 6:50168602-50168624 GCTTCAGCCTCCCAGCATGCTGG + Intergenic
1010440226 6:75885390-75885412 ACTACAGGCACACACCATGCTGG - Intronic
1010571064 6:77475131-77475153 GCTACATCCAATGACCATGCAGG + Intergenic
1012300173 6:97577871-97577893 GCTGCAGCGATACACCATGGCGG + Intergenic
1013097827 6:106962180-106962202 GCTTCAGCCTCCCAACATGCTGG + Intergenic
1014342553 6:120228013-120228035 GCTTCAGACACTCAACATGAGGG - Intergenic
1015388354 6:132651897-132651919 GATGCAGCATGTCACCATGCAGG - Intergenic
1015829085 6:137348196-137348218 GCTTCAGCCTCTCAAAATGCTGG - Intergenic
1016091479 6:139984536-139984558 GCTGCTGCGACTGAACATGCTGG + Intergenic
1016977626 6:149824607-149824629 GCCTCAGCCTCCCACCATGCTGG - Intronic
1018746375 6:166765178-166765200 GCTGCACACACTACCCATGCTGG - Intronic
1019116289 6:169765122-169765144 CGTGCAGCCAATCCCCATGCAGG - Intronic
1019669592 7:2270352-2270374 ACTACAGGCACGCACCATGCTGG - Intronic
1023157474 7:37265566-37265588 GGTGGAGACACTCTCCATGCAGG - Intronic
1023222439 7:37933165-37933187 GCCGCGGCCACTTGCCATGCTGG - Intronic
1023594576 7:41815444-41815466 ACTGCAGCCACACTGCATGCTGG - Intergenic
1023807731 7:43885805-43885827 GCTGCAGCCACTCACCATGCAGG + Intronic
1023837708 7:44078075-44078097 GGTGCTGCCACTGAGCATGCTGG - Intronic
1024240639 7:47432689-47432711 GCTGCTTCCACCCACAATGCAGG - Intronic
1026534784 7:71230569-71230591 TCCCCAACCACTCACCATGCCGG - Intronic
1026574356 7:71559944-71559966 GCTGCAGCCTCTCAAAGTGCTGG - Intronic
1027199977 7:76057803-76057825 GCTTCTGGCACTCATCATGCTGG + Intronic
1030299074 7:107957138-107957160 GCTGCAGCCTCCCAAAATGCTGG - Intronic
1032010973 7:128347747-128347769 GCAGCAGCCACCCACAGTGCAGG + Intergenic
1032415680 7:131733614-131733636 GCTGCAGCCTCAAACCCTGCAGG - Intergenic
1032594784 7:133228556-133228578 ACTGCACCCACTCACCCTACAGG + Intergenic
1032850506 7:135790989-135791011 GATGCAGCCAGTCACCAGGTAGG + Intergenic
1032990565 7:137390453-137390475 GCTGTAGCCAATAGCCATGCAGG - Intronic
1034269515 7:149796851-149796873 GCTGCAGCTCCTCAGCATGCAGG - Intergenic
1035744652 8:1952838-1952860 GATGCAGCCACTCAGACTGCAGG - Intronic
1036296192 8:7540088-7540110 GCTGCAGAAACCCCCCATGCTGG - Intronic
1036326374 8:7780931-7780953 GCTGCAGAAACCCCCCATGCTGG + Intronic
1039296276 8:36159260-36159282 ACTGCAGGAATTCACCATGCAGG + Intergenic
1039379376 8:37070660-37070682 GTTGCAGCAACTCACCAGACAGG - Intergenic
1039502793 8:38030590-38030612 GCTGCAGCCAGACCCCAAGCCGG + Exonic
1039926071 8:41933369-41933391 GCTGCAGCTGCTGCCCATGCTGG + Exonic
1040287880 8:46109713-46109735 GCCGCAGCCACTCAACACGTTGG - Intergenic
1042211449 8:66385165-66385187 GCTCCAGCAACTCAGCATGTTGG + Intergenic
1049173442 8:141176466-141176488 GCTGCAGGCACGCATCCTGCTGG - Intronic
1050502238 9:6310930-6310952 GCTTCAGCCACTGTCCATTCTGG + Intergenic
1053202786 9:36164099-36164121 ACGGCAGCCAATCACCAGGCTGG + Intergenic
1058683801 9:107463551-107463573 GCTTCAGCCTCTCAAAATGCTGG + Intergenic
1058704519 9:107627568-107627590 ACTGCAGCCACTCACCAGCTGGG + Intergenic
1059667535 9:116462991-116463013 GCTGCTGCCATTCACCATGATGG - Intronic
1061849350 9:133405324-133405346 GCTGCTGTCACTCACCAGGCTGG - Exonic
1185613049 X:1403403-1403425 GATGCAGTCACTGAACATGCTGG - Exonic
1185701872 X:2236788-2236810 GCTGCAGCAAATCCCCATACAGG - Intronic
1187176176 X:16898104-16898126 CCTGCAGCCACTCACGTTTCTGG - Intergenic
1188142026 X:26562592-26562614 GGGGTAGCCACTCACCATACAGG - Intergenic
1195374279 X:104211328-104211350 GCTCTAGCCACACACCATGCAGG + Intergenic
1196892052 X:120300642-120300664 GCTTCAGCCTCTCAAAATGCTGG + Intronic
1200894980 Y:8365924-8365946 GCTGCTGTCACTCACCATCAAGG + Intergenic
1202269497 Y:23057280-23057302 GCTTCAGCCACTCAAAGTGCTGG - Intergenic
1202422491 Y:24691026-24691048 GCTTCAGCCACTCAAAGTGCTGG - Intergenic
1202448298 Y:24979060-24979082 GCTTCAGCCACTCAAAGTGCTGG + Intergenic