ID: 1023811961

View in Genome Browser
Species Human (GRCh38)
Location 7:43918791-43918813
Sequence ACTCCTCCATGGTGCCCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 149}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023811961_1023811969 22 Left 1023811961 7:43918791-43918813 CCCCAAGGGCACCATGGAGGAGT 0: 1
1: 0
2: 3
3: 18
4: 149
Right 1023811969 7:43918836-43918858 CAAGGACATCTTTTTCTACCAGG 0: 1
1: 2
2: 1
3: 19
4: 183
1023811961_1023811966 -10 Left 1023811961 7:43918791-43918813 CCCCAAGGGCACCATGGAGGAGT 0: 1
1: 0
2: 3
3: 18
4: 149
Right 1023811966 7:43918804-43918826 ATGGAGGAGTTCGCTACTGAGGG 0: 1
1: 0
2: 0
3: 5
4: 71
1023811961_1023811967 4 Left 1023811961 7:43918791-43918813 CCCCAAGGGCACCATGGAGGAGT 0: 1
1: 0
2: 3
3: 18
4: 149
Right 1023811967 7:43918818-43918840 TACTGAGGGCACTGACCACAAGG 0: 1
1: 0
2: 3
3: 16
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023811961 Original CRISPR ACTCCTCCATGGTGCCCTTG GGG (reversed) Intronic
900618118 1:3574432-3574454 CCTCCTCCAGGAAGCCCTTGGGG + Intronic
901196151 1:7440929-7440951 CCTCCTACCTCGTGCCCTTGCGG + Intronic
902330134 1:15727271-15727293 ACACCTCCATGGAGCGCTTGGGG + Exonic
903329930 1:22592167-22592189 ACTCCTCCCTGGAGCCCTCTCGG + Intronic
903603898 1:24560952-24560974 ATTGTTCCATGGTGCCCTTGGGG + Intronic
903754407 1:25650992-25651014 ACTCCTCCAAGGAGACCTGGAGG + Intronic
906132976 1:43472374-43472396 ATGCCTCCATGGTGGCCCTGAGG - Intergenic
907319123 1:53591933-53591955 CCTCCTCCATGAAGCCCTTCTGG + Intronic
910366490 1:86470847-86470869 ACTCTCCCCTGGTGCCCCTGTGG + Intronic
912758158 1:112342145-112342167 ACTCCTCCATATGGCCCTTCTGG - Intergenic
913181814 1:116329768-116329790 GCTTCTGAATGGTGCCCTTGTGG - Intergenic
915247573 1:154567639-154567661 ACTCCTCCACCGTGCCGTGGAGG + Intergenic
917967704 1:180188900-180188922 CCTCCTCCCTGGAGTCCTTGTGG + Intronic
920503319 1:206499223-206499245 ACTACTCCTCGGTGCCCGTGTGG + Intergenic
920674855 1:208031744-208031766 ACTTCTGCAGGGTGCCCTGGAGG + Exonic
921075766 1:211699110-211699132 CCTCCCCTACGGTGCCCTTGGGG + Intergenic
921406693 1:214788144-214788166 CCTCCTCCATGATGTCTTTGAGG - Intergenic
921840542 1:219823510-219823532 GCTCCACTATGGTGCCCTGGTGG + Intronic
1063353773 10:5379490-5379512 ATTCCGCCATGCTGCTCTTGTGG - Intergenic
1063620307 10:7641267-7641289 CCTCCTCCATGGTGAAGTTGAGG - Intronic
1067433445 10:46260966-46260988 ATTCCTCCATGCTGCTCTGGTGG + Intergenic
1067799720 10:49350685-49350707 CCTCCTCCATGCTGTCCCTGAGG - Intergenic
1067817562 10:49493856-49493878 GCTCCTCCATGGTGCTTTGGTGG - Intronic
1068920244 10:62475729-62475751 ATCCCGCCATGGTGCCCTCGGGG - Intronic
1069628929 10:69885860-69885882 TCTCCTCCCTCGTGCCCTTTTGG + Intronic
1070680102 10:78442988-78443010 ACTCCTCCATGGGGGCTTTCTGG - Intergenic
1072569750 10:96648220-96648242 ATCCCACCATGGTGCCCTGGAGG + Intronic
1074180579 10:111059451-111059473 ACGCCTCCATGCTGCCCTCCTGG - Intergenic
1075212351 10:120502019-120502041 GCTCCTCCATGCTGCTCTAGAGG + Intronic
1075316144 10:121455171-121455193 TCTCCTTCCTGGTGGCCTTGTGG + Intergenic
1076421805 10:130337206-130337228 CCTCCTCCATGCTGCCCTCCTGG + Intergenic
1077210745 11:1370006-1370028 GCTCCTCCATGGGGCTCATGGGG - Intergenic
1077664010 11:4092373-4092395 ACTCCCCCATGGATCCCTGGAGG - Exonic
1078514468 11:12009818-12009840 ACTCCTCTATGCCACCCTTGAGG - Intergenic
1080662687 11:34310479-34310501 AGTACTCCATGGTGCCCTTGTGG + Intronic
1085726030 11:78955421-78955443 TCTGCTCCATGGATCCCTTGTGG - Intronic
1090178475 11:124673217-124673239 CCCCCTCAGTGGTGCCCTTGGGG - Intronic
1090416432 11:126543698-126543720 CCTCTCCCATGGTGCCCTTGGGG + Intronic
1090960190 11:131549517-131549539 ATTACTCCATGGTGTCATTGTGG - Intronic
1092782780 12:12002830-12002852 ACTCCTCTCTGGAGCCCTTGGGG - Intergenic
1097347138 12:58505959-58505981 CCTCCACCCTGGTGACCTTGGGG + Intergenic
1101725078 12:107382180-107382202 CCTCCTCCAGGGGGCCCTTATGG - Intronic
1104281090 12:127378413-127378435 ACTCCTGCCTGGTGCCCAGGAGG + Intergenic
1104926285 12:132315713-132315735 ACTCAGCCCTGGTGTCCTTGCGG + Intronic
1107287110 13:38806164-38806186 ACTTCTCCATGTTTCACTTGTGG + Intronic
1107330261 13:39292169-39292191 ACTCTTCCTTGGTGCCCATTTGG + Intergenic
1112307517 13:98288504-98288526 ATTTCTCCTTGGTGCGCTTGTGG + Intronic
1122419024 14:101563924-101563946 ACTCCTCCCTGGCCCCCTTCCGG + Intergenic
1122824836 14:104364556-104364578 GGTCTTCCATGGTGCCCTGGAGG + Intergenic
1126786248 15:52179795-52179817 CCTCCTCCAGCTTGCCCTTGAGG + Exonic
1128696131 15:69764205-69764227 ATTCTTCCCTGGTGCCCCTGGGG + Intergenic
1129783159 15:78288097-78288119 CCTCCTCCAAGCAGCCCTTGAGG + Intronic
1130756554 15:86770559-86770581 AATCCTCCATCGTGCAATTGCGG - Intronic
1134510727 16:14844876-14844898 ACTTATCCATGGGTCCCTTGTGG - Intronic
1134698366 16:16243363-16243385 ACTTATCCATGGGTCCCTTGTGG - Intronic
1134973468 16:18551315-18551337 ACTTATCCATGGGTCCCTTGTGG + Intronic
1136514484 16:30759698-30759720 ACTCCTCCACGTTGCCCAAGGGG + Exonic
1138228729 16:55323181-55323203 ACTCCTCCAAGGAGCCATAGGGG - Intergenic
1139202361 16:64991126-64991148 ATTTCTGCCTGGTGCCCTTGGGG + Intronic
1141387185 16:83632577-83632599 ACTACTCCGTGGGGCACTTGAGG - Intronic
1141668684 16:85480174-85480196 ACTCCTGGCTGGGGCCCTTGAGG - Intergenic
1142527016 17:550220-550242 ACTCCTCCAGGGTTTCCTTTGGG - Intronic
1143165637 17:4896037-4896059 ACACCTCCACGGAGCTCTTGAGG - Exonic
1143417084 17:6758179-6758201 GCTCCTCCATGGTTTCCTTGGGG - Exonic
1144765234 17:17728937-17728959 ACTTCTCCATGGCGCCCCTGAGG + Intronic
1144778839 17:17797945-17797967 TCTCCTCCACGATGCACTTGGGG + Exonic
1145230406 17:21169752-21169774 ACTCCTCCGTGGGCCCCTGGAGG - Intronic
1147732071 17:42610154-42610176 ACTCCTCCACGATGCCCTCGGGG - Exonic
1147739029 17:42659880-42659902 ATTCCTCCACGATGCCCTCGGGG - Exonic
1148462686 17:47847403-47847425 CCTCCTCCTTGGCGCCCTCGTGG + Exonic
1148991698 17:51671800-51671822 TCTCCTCCATGCTGGCCTTCTGG + Intronic
1149650048 17:58271099-58271121 CCTCCAGCATGGTGCCCTGGAGG - Intronic
1150069094 17:62137455-62137477 ACTCCACCACGGAGCCCGTGTGG + Intergenic
1150283202 17:63941172-63941194 TCTCCTCCATGGTCTGCTTGAGG + Exonic
1155123161 18:22843282-22843304 ACTCCTCCGTGGTTCCTTAGGGG - Intronic
1155500432 18:26482116-26482138 ACCCCACCATGCTGCCCCTGTGG + Intronic
1157196722 18:45625823-45625845 ACTCCTTCATGTCGCCCGTGAGG - Exonic
1159983908 18:74819736-74819758 AAACCTGCATGGTGCCTTTGGGG - Intronic
1160448176 18:78943225-78943247 GCTCCTCCATGGTGCTCCTCTGG + Intergenic
1163490391 19:17614398-17614420 TGTCCTCCATGGTGCCAATGGGG + Intronic
1163516026 19:17764369-17764391 TCTCCTCGATGGTGGCCCTGGGG - Exonic
1164729494 19:30491781-30491803 ACTCCTCTGTGGGTCCCTTGGGG + Intronic
1165480788 19:36062795-36062817 ACTCCTGAATGGTGCCCTCTGGG - Intronic
1165845803 19:38816974-38816996 ACTCTTCCATGAAGCCCTCGAGG + Intronic
1167705005 19:51076778-51076800 CCTCCTCCCTGGAGCCCCTGTGG - Intergenic
1168432797 19:56294569-56294591 ACTACTCAATGCTGCCTTTGTGG + Intronic
925246908 2:2391748-2391770 AGTTCTCAATGGTGCCCTTGTGG - Intergenic
933527531 2:83462127-83462149 ACTCCTCCATAGGGCATTTGAGG - Intergenic
934639776 2:96020914-96020936 ACTACTGCCTGGTGCTCTTGGGG + Intergenic
937925271 2:127162943-127162965 ATGCCTCCATGCAGCCCTTGTGG - Intergenic
937980970 2:127615168-127615190 ACTCCTCCTTGGTGCACCTGTGG - Intronic
938320459 2:130359104-130359126 ATCCCACCAAGGTGCCCTTGTGG - Intronic
941989516 2:171541403-171541425 ACTCCTCCACCGTCCCCTAGAGG + Intronic
942134211 2:172909259-172909281 ACTCTTGCGTGGTGGCCTTGAGG - Intronic
945479266 2:210325168-210325190 AATCCTCCCTGGTGCCCTTTTGG + Intergenic
946047678 2:216834758-216834780 TCTCCTCTATGGCTCCCTTGTGG + Intergenic
947024647 2:225723361-225723383 ACACCTCCATGGTACCCTTCTGG - Intergenic
948665100 2:239529664-239529686 CCTCCTCCCAGGTGCCCGTGGGG - Intergenic
1170158034 20:13286266-13286288 GCACCTCTCTGGTGCCCTTGGGG + Intronic
1170996946 20:21370937-21370959 TCTCCCCCATGCTGCCCTTGTGG - Intronic
1171349295 20:24490603-24490625 ACCCCTCCATGGTGTCGTCGGGG + Intronic
1171420199 20:25012756-25012778 ACACCTCCATGATGCCCCTGTGG - Intronic
1172995127 20:39064773-39064795 ACTCCTCCATGGCACCCAGGAGG - Intergenic
1174402188 20:50282125-50282147 CCTCCTCCCTGCTGACCTTGGGG + Intergenic
1174696222 20:52561278-52561300 ATTCCTCCATGCTGCCCTCCTGG + Intergenic
1177385099 21:20397904-20397926 ACTACTCCATGTTTCCCATGAGG - Intergenic
1180024067 21:45148575-45148597 ACTCCTCCAAGCTTCCCCTGTGG - Intronic
1181174745 22:21029117-21029139 TCTCCTCCAGGCTGCCCCTGGGG + Exonic
950168934 3:10822903-10822925 GATCGTCCATGGTGACCTTGGGG - Intronic
951519512 3:23598236-23598258 ACTTCACGATGGTGGCCTTGGGG + Intergenic
951558718 3:23945566-23945588 TCACCTCCATGGTGCCCTCGCGG - Exonic
952966567 3:38624586-38624608 ATTCCTCCATGGCCACCTTGGGG - Intronic
954687794 3:52380003-52380025 ACTGCTCCATGCAGCGCTTGAGG - Exonic
959945381 3:112120268-112120290 ACTTTTCCCTGGAGCCCTTGTGG + Intronic
961450581 3:127000577-127000599 ACTCCTCCCAGGTGCAGTTGCGG + Intronic
961748620 3:129082087-129082109 ATTACTCCAAGGAGCCCTTGAGG - Intergenic
962703739 3:138023749-138023771 AGTCCTCCATGCTGCCAATGCGG - Exonic
964662048 3:159131092-159131114 ATTCCTCCATGCTGCTCTTGTGG - Intronic
966037991 3:175444389-175444411 ACTGCTCCAGGCTGCACTTGAGG - Intronic
966430515 3:179827335-179827357 ACACCTCCATGGGGCCTTTGAGG - Intronic
968668545 4:1834910-1834932 TCTCCTCGATGGTGTCCTGGAGG + Exonic
969258741 4:6020866-6020888 CCTCCTCCTTGGTGGCCCTGGGG - Intergenic
975870869 4:78776687-78776709 ACTCTTCCAGGGTGACCTGGTGG - Exonic
977562310 4:98544961-98544983 CCTCCTCCATTCTGACCTTGTGG + Intronic
982914972 4:161196361-161196383 ACTTCCCCATTGTTCCCTTGAGG - Intergenic
984834933 4:184010772-184010794 ACTCCTCCAGGGAGCCTGTGGGG + Exonic
984883295 4:184429055-184429077 CCACCGGCATGGTGCCCTTGAGG + Exonic
987831324 5:23099537-23099559 ACTCTTCCTTGCTTCCCTTGTGG + Intergenic
997365271 5:133321505-133321527 ACTCCTCCCTGGTGCCCCTGTGG + Intronic
998491400 5:142550398-142550420 ACTCCTCTCAGGTGCCCCTGGGG + Intergenic
1000731329 5:164837501-164837523 GCCCCTCCATGTTGCCCCTGTGG + Intergenic
1003068004 6:2919639-2919661 CCTCTTCCCTGCTGCCCTTGTGG - Intergenic
1005806474 6:29478275-29478297 GCTCCTGCTTGGTGCCCTGGTGG - Intergenic
1009481513 6:64164078-64164100 ACTCCTAAATGGTGATCTTGAGG + Intronic
1012829365 6:104186418-104186440 ACACCTCCATAGTGGCCCTGTGG - Intergenic
1016506040 6:144780679-144780701 ACTCCTCCTTCGGGCCTTTGCGG + Intronic
1017670481 6:156765355-156765377 AGTCCACCATGGTGCCCCTCAGG - Intergenic
1017775377 6:157676374-157676396 ACTCCTCCCTTGTGCCATTCTGG - Exonic
1019290838 7:249278-249300 CCTGGTCCCTGGTGCCCTTGAGG + Intronic
1020788617 7:12597529-12597551 AATGCTCAATGGTGCCCTTGAGG - Intronic
1023629100 7:42145868-42145890 CCTGCTCCATGGTGTTCTTGTGG - Intronic
1023811961 7:43918791-43918813 ACTCCTCCATGGTGCCCTTGGGG - Intronic
1023868441 7:44249967-44249989 ACCTCTCCATGGTGTCCTTAAGG + Intronic
1026952383 7:74356285-74356307 ACACCTCCTTGGGGCCCATGTGG - Intronic
1032064752 7:128758959-128758981 ACTCCTCCTTGGTGGCAATGAGG - Exonic
1032468422 7:132161298-132161320 ACAACTCCATGGTGCACTTCAGG + Intronic
1033608010 7:142941525-142941547 AATGCTCCATGTGGCCCTTGGGG - Intronic
1033810190 7:145002785-145002807 AAATCTCCATGGTGCCCTTAAGG - Intergenic
1034391388 7:150790328-150790350 ACTCCTCAACTCTGCCCTTGTGG + Intergenic
1034429979 7:151036371-151036393 ACGCCTCCATGGCCTCCTTGAGG - Intronic
1042439345 8:68807894-68807916 ACTCCTCCAGTGTGGCCTTTCGG + Intronic
1045173548 8:99696647-99696669 TCTCCTCGATGGTGTCCTGGAGG - Intronic
1045390000 8:101705727-101705749 TCTCCTCCATGGTGGCTTTGGGG - Intronic
1048592587 8:135834595-135834617 AGTCCTGCATTCTGCCCTTGTGG - Intergenic
1048987271 8:139741222-139741244 ACTCCTCCTTGGTGCTCCTCTGG + Intronic
1049334151 8:142073606-142073628 ACTGCTCCCTGGTGGCATTGTGG + Intergenic
1049939657 9:533206-533228 ACCCCTCCAAATTGCCCTTGGGG - Intronic
1052460955 9:28762378-28762400 ACTCCCCCAAGGTGCTCTTTAGG + Intergenic
1053506598 9:38648790-38648812 ACTCCTGCATGTTGCCATTATGG + Intergenic
1056622838 9:88228603-88228625 CCTACCTCATGGTGCCCTTGTGG - Intergenic
1057208633 9:93187654-93187676 TCTCCTCACTGGTGACCTTGGGG - Intronic
1061367080 9:130177678-130177700 ACTCGGCCTTGGTGACCTTGGGG + Intronic
1061897993 9:133658467-133658489 CCTCCTCCATGCTGTCCCTGTGG + Exonic
1061939111 9:133874616-133874638 ACCCCTCCCTCCTGCCCTTGAGG - Intronic
1062293618 9:135811252-135811274 ACTCGTAAATGATGCCCTTGTGG - Exonic
1062328000 9:136021951-136021973 ACCCCTCCATGCTGCCCTTGAGG - Intronic
1062500801 9:136851218-136851240 CCTCCTCCAAGATGCCCTGGAGG - Intronic
1203416714 Un_KI270330v1:240-262 ATTTCTCCATGGTTCCCGTGAGG + Intergenic
1203550760 Un_KI270743v1:163846-163868 ATTACTCCATGGTTCCCGTGAGG + Intergenic
1196608693 X:117685917-117685939 ACTGGTCCCTGGTGCCCTAGTGG + Intergenic
1198185904 X:134253993-134254015 ACTCTTCCAAGGTTCCCTTCTGG - Intergenic