ID: 1023813677

View in Genome Browser
Species Human (GRCh38)
Location 7:43931780-43931802
Sequence CAGTTGAACCAGAGAGACGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 23741
Summary {0: 1, 1: 3, 2: 88, 3: 2175, 4: 21474}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023813677_1023813679 -1 Left 1023813677 7:43931780-43931802 CCTCCGTCTCTCTGGTTCAACTG 0: 1
1: 3
2: 88
3: 2175
4: 21474
Right 1023813679 7:43931802-43931824 GATTCTCCTGTGTCAGCCTCTGG 0: 8
1: 219
2: 3374
3: 6850
4: 4544
1023813677_1023813682 23 Left 1023813677 7:43931780-43931802 CCTCCGTCTCTCTGGTTCAACTG 0: 1
1: 3
2: 88
3: 2175
4: 21474
Right 1023813682 7:43931826-43931848 GTAGTGTGTGCCACCATGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023813677 Original CRISPR CAGTTGAACCAGAGAGACGG AGG (reversed) Intronic
Too many off-targets to display for this crispr