ID: 1023816102

View in Genome Browser
Species Human (GRCh38)
Location 7:43951213-43951235
Sequence ACAATTCTGGGTCTGTTAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 722
Summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 688}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023816102_1023816106 1 Left 1023816102 7:43951213-43951235 CCAATTAACAGACCCAGAATTGT 0: 1
1: 0
2: 0
3: 33
4: 688
Right 1023816106 7:43951237-43951259 AAATTCCGACCCCCTAGGCCAGG 0: 1
1: 0
2: 0
3: 4
4: 89
1023816102_1023816113 28 Left 1023816102 7:43951213-43951235 CCAATTAACAGACCCAGAATTGT 0: 1
1: 0
2: 0
3: 33
4: 688
Right 1023816113 7:43951264-43951286 ACCACATGCACTGTAGCATGAGG 0: 1
1: 0
2: 0
3: 9
4: 119
1023816102_1023816105 -4 Left 1023816102 7:43951213-43951235 CCAATTAACAGACCCAGAATTGT 0: 1
1: 0
2: 0
3: 33
4: 688
Right 1023816105 7:43951232-43951254 TTGTAAAATTCCGACCCCCTAGG No data
1023816102_1023816115 29 Left 1023816102 7:43951213-43951235 CCAATTAACAGACCCAGAATTGT 0: 1
1: 0
2: 0
3: 33
4: 688
Right 1023816115 7:43951265-43951287 CCACATGCACTGTAGCATGAGGG 0: 1
1: 0
2: 0
3: 13
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023816102 Original CRISPR ACAATTCTGGGTCTGTTAAT TGG (reversed) Intronic
903371239 1:22837533-22837555 GCAACTCTGGGTATGTTACTTGG - Intronic
904230197 1:29063180-29063202 CCAATACTGGGTCTTTGAATGGG + Intronic
905030177 1:34877024-34877046 ACAATGCTGGGTTTGAAAATAGG + Intronic
906238241 1:44225009-44225031 ACAGATCTGGGGCTTTTAATAGG + Intronic
906886995 1:49659346-49659368 GCCATTCTGTGTCTTTTAATTGG - Intronic
906894148 1:49753027-49753049 GCCAGTCTGTGTCTGTTAATTGG + Intronic
906903978 1:49867905-49867927 GCCATTCTGTGTCTTTTAATTGG - Intronic
907045027 1:51295359-51295381 CCATTTCTGGGTCTGCAAATTGG + Intronic
908913535 1:69100491-69100513 GCCATTCTGTGTCTTTTAATTGG + Intergenic
909049381 1:70750224-70750246 GCCATTCTGTGTCTTTTAATTGG + Intergenic
909082639 1:71131668-71131690 ACAACTCTATGTCTATTAATTGG - Intergenic
909374699 1:74926115-74926137 ACCATTCTGCATCTTTTAATTGG - Intergenic
909449211 1:75779777-75779799 ACCAGTCTGTGTCTTTTAATTGG - Intronic
909628431 1:77745380-77745402 GCCAGTCTGGGTCTTTTAATTGG + Intronic
909678040 1:78259315-78259337 GCCATTCTGTGTCTTTTAATTGG - Intergenic
909841585 1:80334154-80334176 TCAAGTCTGTGTCTTTTAATTGG - Intergenic
910105509 1:83627578-83627600 ACATATATGGGTCTCTTAATAGG - Intergenic
910157197 1:84232872-84232894 CCAAGTCTGTGTCTTTTAATTGG + Intronic
910639188 1:89441468-89441490 GGAATTCTGGGTCTGTAAACTGG + Intergenic
910805512 1:91186647-91186669 GCCATTCTGTGTCTTTTAATTGG + Intergenic
910812246 1:91250523-91250545 ACCAGTCTGTGTCTTTTAATTGG + Intergenic
910911189 1:92236067-92236089 GCCATTCTGTGTCTTTTAATTGG + Intronic
911109094 1:94164168-94164190 ACAACTCTTGGCCTGTTACTGGG - Intronic
911364801 1:96925074-96925096 ACTATTCTTGGTTTGTTACTGGG + Intergenic
911560826 1:99403776-99403798 GCCATTCTGTGTCTTTTAATTGG + Intergenic
911689328 1:100814193-100814215 GCAATTCTGTATCTTTTAATTGG - Intergenic
911980429 1:104559458-104559480 ACAACTCTTGGCCTGTTACTAGG + Intergenic
912129908 1:106588013-106588035 ACAACTCTTGGCCTGTTACTGGG - Intergenic
912276547 1:108264070-108264092 GCCATTCTGTGTCTTTTAATTGG - Intergenic
912291681 1:108430288-108430310 GCCATTCTGTGTCTTTTAATTGG + Intronic
912874316 1:113341798-113341820 GCCATTCTGTGTCTTTTAATTGG - Intergenic
912886172 1:113477185-113477207 GCCATTCTGTGTCTTTTAATTGG + Intronic
912893409 1:113559236-113559258 GCTATTCTGTGTCTTTTAATTGG - Intronic
913721610 1:121602149-121602171 GCCATTCTGTGTCTTTTAATTGG + Intergenic
914218211 1:145653922-145653944 GCCATTCTGTGTCTTTTAATTGG + Intronic
914470772 1:147976603-147976625 GCCATTCTGTGTCTTTTAATTGG + Intronic
915046371 1:153020497-153020519 TCCATTCTGTGTCTTTTAATTGG - Intergenic
915807243 1:158866889-158866911 ACCAGTCTGTGTCTTTTAATTGG - Intergenic
915858067 1:159411657-159411679 GCCAGTCTGTGTCTGTTAATTGG + Intergenic
916182955 1:162103865-162103887 GCCATTCTGTGTCTTTTAATTGG + Intronic
916409159 1:164527978-164528000 AAAATTCTGGGTCTTTTTTTAGG - Intergenic
917009520 1:170455681-170455703 GCCATTCTGGGTCTTTTAATTGG + Intergenic
917305441 1:173619321-173619343 GCCATTCTGTGTCTCTTAATTGG - Intronic
917401191 1:174651794-174651816 GCAAGTCTGTGTCTTTTAATTGG + Intronic
917603192 1:176597992-176598014 ACACTACTGGGTCTATAAATAGG - Intronic
918614586 1:186530120-186530142 GCCATTCTGTGTCTTTTAATTGG + Intergenic
918676113 1:187288089-187288111 ACATATGTGGGTCTGTCAATTGG + Intergenic
918697103 1:187558613-187558635 ACCAGTCTGTGTCTTTTAATTGG + Intergenic
918789698 1:188811053-188811075 GCCATTCTGTGTCTTTTAATTGG + Intergenic
918839451 1:189515055-189515077 GCCATTCTGTGTCTTTTAATTGG - Intergenic
918918228 1:190671842-190671864 ACAGCTCTTGGCCTGTTAATGGG - Intergenic
918982712 1:191584348-191584370 GCCATTCTGTGTCTTTTAATTGG + Intergenic
921777142 1:219114193-219114215 GCCATTCTGTGTCTTTTAATTGG - Intergenic
921918920 1:220644102-220644124 GCCATTCTGTGTCTTTTAATTGG - Intronic
921981248 1:221261443-221261465 GCCATTCTGTGTCTTTTAATTGG + Intergenic
922360968 1:224821026-224821048 ACATTTCTGTGTCTGTGAAGTGG + Intergenic
922395818 1:225200283-225200305 GCAATTCTGTGTCTTTTAAGTGG + Intronic
922406009 1:225314393-225314415 ACCAGTCTGTGTCTTTTAATTGG + Intronic
923195244 1:231660427-231660449 GCCATTCTGTGTCTTTTAATTGG + Intronic
924412612 1:243821466-243821488 GCCATTCTGTGTCTTTTAATTGG - Intronic
924463357 1:244279268-244279290 ACAATTCTCAGGTTGTTAATAGG + Intergenic
924493778 1:244566805-244566827 GCCATTCTGTGTCTTTTAATTGG + Intronic
924629786 1:245725865-245725887 GCCATTCTGTGTCTTTTAATTGG - Intergenic
924652487 1:245942161-245942183 GCCATTCTGTGTCTTTTAATTGG - Intronic
924663750 1:246048465-246048487 AAAATACTGGGTCCATTAATGGG + Intronic
1062968798 10:1630210-1630232 ACCATTCTGGGTCCATGAATGGG + Intronic
1064370258 10:14746254-14746276 GCCATTCTGTGTCTTTTAATTGG + Intronic
1065157231 10:22882856-22882878 GCCATTCTGTGTCTTTTAATTGG - Intergenic
1065294712 10:24263321-24263343 AAAATTCTGGGTCGTTTCATGGG + Intronic
1065477041 10:26150129-26150151 ACAATGCTGTATCTGTTAAATGG + Intronic
1066051617 10:31641775-31641797 ACCAGTCTGTGTCTTTTAATTGG + Intergenic
1066813399 10:39371075-39371097 CCCATTCTGTGTCTTTTAATTGG + Intergenic
1066930424 10:41751378-41751400 ACCAGTCTGTGTCTTTTAATTGG - Intergenic
1066933843 10:41801838-41801860 ACCAGTCTGTGTCTTTTAATTGG + Intergenic
1067052876 10:43034066-43034088 GCCATTCTAGGTCTTTTAATGGG + Intergenic
1067234023 10:44433010-44433032 ACCATTCTGTGTCTTTTAAGTGG + Intergenic
1067252245 10:44596356-44596378 ACCAGTCTGTGTCTTTTAATTGG - Intergenic
1067789667 10:49278242-49278264 ACAATGCTGGCTCTGCTGATGGG + Intergenic
1067923425 10:50482741-50482763 GCCATTCTGTGTCTTTTAATTGG - Intronic
1068410159 10:56644548-56644570 GCCATTCTGTGTCTTTTAATTGG + Intergenic
1068519037 10:58059122-58059144 GCCATTCTGTGTCTTTTAATTGG - Intergenic
1068640022 10:59393176-59393198 ATAGATCTGGGTCTGTAAATAGG + Intergenic
1071027979 10:81138470-81138492 GCCATTCTGTGTCTTTTAATTGG - Intergenic
1071035250 10:81237262-81237284 GCCATTCTGTGTCTTTTAATTGG + Intergenic
1071881968 10:89909356-89909378 GCCATTCTGTGTCTTTTAATTGG + Intergenic
1071999730 10:91183524-91183546 GCCATTCTGTGTCTTTTAATTGG + Intronic
1072343597 10:94480298-94480320 AGGATTCTGGGTCTGTAAACTGG + Intronic
1072377067 10:94828622-94828644 GCAAGTCTGTGTCTTTTAATTGG + Intronic
1072807083 10:98430439-98430461 ACAATTCTGGGTGTGTGGTTGGG - Intronic
1073557352 10:104465937-104465959 ACAGCTCTTGGTCTGTTACTGGG + Intergenic
1074636117 10:115319850-115319872 GCAAGTCTGTGTCTTTTAATTGG + Intronic
1074654381 10:115567545-115567567 ACAATTCTTCATCTTTTAATAGG - Intronic
1074682776 10:115925442-115925464 ACCAGTCTGTGTCTTTTAATTGG - Intronic
1074995041 10:118749538-118749560 GCATTTCTGTGTCTGTGAATAGG - Intronic
1075230658 10:120673424-120673446 GCTATTCTGTGTCTTTTAATTGG - Intergenic
1075444199 10:122502574-122502596 AGACTTCTGGCTCTGTTAAGAGG + Intronic
1076933167 10:133547556-133547578 AGCATTCTGGGTCTTTTAATTGG - Intronic
1077655456 11:4015008-4015030 ACCACTCTGTGTCTTTTAATTGG + Intronic
1078166597 11:8891423-8891445 ACTAGTCTGTGTCTTTTAATTGG - Intronic
1078292879 11:10032227-10032249 ACGATTTTGGGTTTGTTAAGCGG - Intronic
1079406715 11:20154088-20154110 ACACTTTTGTGTCTGTTGATTGG + Intergenic
1079668035 11:23132786-23132808 TCCATTCTGTGTCTTTTAATTGG + Intergenic
1079738100 11:24023194-24023216 GCCATTCTGTGTCTTTTAATTGG - Intergenic
1079752331 11:24214509-24214531 GCCATTCTGTGTCTTTTAATGGG - Intergenic
1080221201 11:29906768-29906790 GCCATTCTGTGTCTTTTAATTGG - Intergenic
1081072779 11:38631132-38631154 ACATTTCTTGGCCTGTTACTGGG + Intergenic
1081185662 11:40039335-40039357 ACCACTCTGTGTCTTTTAATTGG - Intergenic
1081745292 11:45468587-45468609 CCATTTCTGGGTCTGTGAAAAGG - Intergenic
1082104121 11:48201575-48201597 ACCATTCTGTGTCTTTTAAGTGG - Intergenic
1082586654 11:54949012-54949034 ACCAGTCTGTGTCTTTTAATTGG - Intergenic
1082620114 11:55410177-55410199 TCAAGTCTGTGTCTTTTAATTGG + Intergenic
1082871918 11:57951493-57951515 GCCATTCTGTGTCTTTTAATTGG + Intergenic
1082994161 11:59235756-59235778 GCCATTCTGTGTCTTTTAATTGG - Intergenic
1083062599 11:59890235-59890257 GCCATTCTGTGTCTTTTAATTGG + Intergenic
1083783733 11:64931963-64931985 CCAATCCCGGGTCTGGTAATGGG + Intronic
1084512588 11:69615594-69615616 TCACTTCTGGGTCTGTTTCTAGG - Intergenic
1085334942 11:75686090-75686112 GCCATTCTGTGTCTTTTAATTGG + Intergenic
1086352705 11:85959140-85959162 ACACTTCTGGGCCAGTTAAATGG - Intronic
1087341150 11:96909031-96909053 ACAATCCTGTGTCTGTTAGGTGG + Intergenic
1087712453 11:101569043-101569065 GCCATTCTGTGTCTTTTAATTGG - Intronic
1087878728 11:103390456-103390478 ACCAGTCTGTGTCTTTTAATTGG + Intronic
1088020610 11:105113645-105113667 GCCATTCTGTGTCTTTTAATTGG - Intergenic
1088191658 11:107234479-107234501 ACAGTTCTTGGCCTGTTACTGGG - Intergenic
1088508803 11:110553791-110553813 ACCAGTCTGTGTCTTTTAATTGG + Intergenic
1089138605 11:116269097-116269119 ACTATACTGGGTCTGTTGTTTGG + Intergenic
1089969939 11:122685093-122685115 CCAATTCTGGGTCTTTTCCTTGG + Intronic
1090637983 11:128704616-128704638 AGAATTTTGAGTCTCTTAATGGG + Intronic
1090753984 11:129772575-129772597 ACAATTCTTGGTCTGCTACTGGG - Intergenic
1092209675 12:6638179-6638201 CCCCTTCTGGGTCTGTTACTCGG - Exonic
1092398328 12:8148194-8148216 GCCATTCTGTGTCTTTTAATTGG - Intronic
1093085291 12:14860668-14860690 GCCATTCTGTGTCTTTTAATTGG + Intronic
1093771711 12:23025593-23025615 ACAATTTTGGCTCTGTTAGGGGG + Intergenic
1093991620 12:25594766-25594788 GCAATTCTGAGTCTTTTAAGTGG - Intronic
1094206891 12:27850084-27850106 GCCATTCTGTGTCTTTTAATTGG + Intergenic
1094431835 12:30378532-30378554 GCCATTCTGTGTCTTTTAATTGG + Intergenic
1094465518 12:30750208-30750230 AAAATTCTGGGTCAGTGAAGAGG + Intronic
1094755625 12:33464899-33464921 GCCATTCTGTGTCTTTTAATTGG - Intergenic
1095595528 12:43953333-43953355 GCCATTCTGTGTCTTTTAATGGG - Intronic
1095694289 12:45127067-45127089 GCAACTCTAGGTCTGTGAATTGG + Intergenic
1095844393 12:46729956-46729978 ACAGCTCTTGGCCTGTTAATGGG - Intergenic
1096051508 12:48613533-48613555 GCCATTCTGTGTCTTTTAATTGG + Intergenic
1096957761 12:55544326-55544348 ACCAGTCTGTGTCTTTTAATTGG + Intergenic
1097150053 12:56970475-56970497 ACCAGTCTGTGTCTTTTAATTGG - Intergenic
1097275241 12:57808736-57808758 ACATTTTTGGATCTGTTTATTGG + Intronic
1097595462 12:61623162-61623184 ACAATTCTTTGTCTTTTAAATGG - Intergenic
1097749179 12:63332760-63332782 ACCAGTCTGTGTCTTTTAATTGG - Intergenic
1097890796 12:64775313-64775335 GCCATTCTGTGTCTTTTAATTGG - Intergenic
1098054297 12:66487666-66487688 GCCATTCTGTGTCTTTTAATTGG - Intronic
1098697281 12:73574574-73574596 GCCATTCTGTGTCTTTTAATTGG - Intergenic
1098704816 12:73673570-73673592 GCCATTCTGTGTCTTTTAATTGG - Intergenic
1098764323 12:74467473-74467495 GCCATTCTGTGTCTTTTAATTGG + Intergenic
1099053242 12:77807134-77807156 GCCAGTCTGTGTCTGTTAATTGG + Intergenic
1099369735 12:81814136-81814158 GCCATTCTGTGTCTTTTAATTGG - Intergenic
1099878660 12:88439153-88439175 ACAAGTGTGTGTCTTTTAATTGG - Intergenic
1100115310 12:91296384-91296406 TCCATTCTGTGTCTTTTAATTGG - Intergenic
1100312367 12:93408206-93408228 ACAATTCTTGGGCTGTTTAAAGG - Exonic
1100918728 12:99457462-99457484 ACCATTCTGTGTCTTTTAAGTGG - Intronic
1102840007 12:116108974-116108996 TCATTTCAGGGTCTGTTACTTGG - Intronic
1104176631 12:126339285-126339307 AGAAATCCTGGTCTGTTAATGGG - Intergenic
1104659326 12:130598844-130598866 ACATTTGTGGGTCTATTTATGGG - Intronic
1105244160 13:18633030-18633052 GCAAGTCTGTGTCTTTTAATTGG - Intergenic
1105335458 13:19463491-19463513 TAAATTTAGGGTCTGTTAATGGG + Intronic
1105740111 13:23315188-23315210 ACAACTCTTGGCCTGTTACTGGG + Intronic
1105859468 13:24395889-24395911 ACAATTTAGAGTCTGTTAATGGG - Intergenic
1106967070 13:35083791-35083813 ACACTGATGGGTCTTTTAATTGG - Intronic
1107243896 13:38269173-38269195 GCCATTCTGTGTCTTTTAATTGG - Intergenic
1107551244 13:41478283-41478305 GCCAGTCTGGGTCTTTTAATTGG + Intergenic
1107959369 13:45544784-45544806 ACAAATCTGCTTCTGTTCATAGG + Exonic
1108630672 13:52278883-52278905 AAAATTTAGGGTCTGTTAATGGG + Intergenic
1108656016 13:52533657-52533679 AAAATTTAGGGTCTGTTAATGGG - Intergenic
1108768523 13:53665372-53665394 GCCATTCTGTGTCTTTTAATTGG + Intergenic
1108771300 13:53703793-53703815 ACATTTCTAGATATGTTAATTGG - Intergenic
1109097019 13:58132056-58132078 GCCATTCTGTGTCTTTTAATTGG + Intergenic
1109146671 13:58788763-58788785 GCCATTCTGTGTCTTTTAATTGG + Intergenic
1109361044 13:61294759-61294781 ATACTTCTGAGCCTGTTAATGGG - Intergenic
1109968963 13:69739435-69739457 GCCATTCTGTGTCTTTTAATTGG - Intronic
1110389941 13:74961650-74961672 ACCAGTCTGTGTCTTTTAATTGG - Intergenic
1111522614 13:89425962-89425984 GCCATTCTGTGTCTTTTAATTGG + Intergenic
1112913622 13:104520679-104520701 TCCATTCTGTGTCTTTTAATTGG + Intergenic
1114432695 14:22675989-22676011 ACCAGTCTGTGTCTTTTAATCGG + Intergenic
1114433186 14:22679996-22680018 ACCAGTCTGTGTCTTTTAATCGG - Intergenic
1114828414 14:26108445-26108467 ACCAGTCTGTGTCTTTTAATTGG - Intergenic
1115388665 14:32828237-32828259 ACAATTCCCATTCTGTTAATTGG + Intronic
1115496156 14:34006874-34006896 AGACTTTTGGGTCTGTTAAAAGG + Intronic
1115698651 14:35926399-35926421 ACACTTCTGAGTCCATTAATGGG - Intronic
1115704583 14:35986096-35986118 ACAATTCTGGCTTTGTTGCTGGG + Intergenic
1116195576 14:41721328-41721350 GCAATTCTGTGCCTGTTAAATGG + Intronic
1116493528 14:45534613-45534635 TCAGTTCTGTGTCTTTTAATTGG + Intergenic
1117073894 14:52081561-52081583 ACAAATTTGGGTTTGTAAATAGG - Intergenic
1117350099 14:54872530-54872552 GCCATTCTGTGTCTTTTAATTGG - Intronic
1117358645 14:54950176-54950198 GCCATTCTGTGTCTTTTAATTGG - Intronic
1117502865 14:56371953-56371975 GCCATTCTGTGTCTTTTAATTGG + Intergenic
1117582591 14:57167972-57167994 ACATGTCTGGGACTGTTGATGGG - Intergenic
1117857305 14:60049213-60049235 GCCATTCTGTGTCTTTTAATTGG + Intronic
1117889880 14:60408385-60408407 GCCATTCTGTGTCTTTTAATTGG + Intronic
1118415012 14:65526521-65526543 ACCAGTCTGTGTCTTTTAATTGG + Intronic
1118479211 14:66146350-66146372 GCCATTCTGTGTCTTTTAATTGG - Intergenic
1118521113 14:66586346-66586368 ACCAGTCTGTGTCTTTTAATTGG + Intronic
1118646822 14:67848540-67848562 ACCATTCTGTGTCTTTTAAGTGG + Intronic
1119865773 14:77972537-77972559 ATAATTCTGGTATTGTTAATTGG + Intergenic
1120058685 14:79955743-79955765 GCCATTCTGTGTCTTTTAATTGG - Intergenic
1120121589 14:80686609-80686631 GCAATTCTGTGTCTTTTAATTGG - Intronic
1120283292 14:82465652-82465674 GCCATTCTGTGTCTTTTAATTGG - Intergenic
1120598546 14:86471923-86471945 ACCAGTCTGTGTCTTTTAATTGG + Intergenic
1120604259 14:86553169-86553191 AGAATTATGTGTATGTTAATTGG - Intergenic
1120642075 14:87027637-87027659 CAAATTCTGGGTTTTTTAATAGG - Intergenic
1120770317 14:88372052-88372074 GCAAGTCTGTGTCTTTTAATTGG - Intergenic
1120832911 14:89013999-89014021 TCATTTCTAGGTCTCTTAATTGG - Intergenic
1121143125 14:91558765-91558787 GCCATTCTGTGTCTTTTAATTGG - Intergenic
1122602775 14:102929723-102929745 ACCTTCCTGGGTCTGGTAATGGG + Exonic
1122828393 14:104383407-104383429 ACAGTTCTAGGTCTCTGAATCGG + Intergenic
1123661924 15:22572083-22572105 AGAGTTCTGGTTCTGATAATGGG - Intergenic
1124197159 15:27641300-27641322 GCCATTCTGTGTCTTTTAATTGG - Intergenic
1124315721 15:28666326-28666348 AGAGTTCTGGTTCTGATAATGGG - Intergenic
1124874118 15:33574812-33574834 GCCATTCTGTGTCTTTTAATTGG - Intronic
1125216430 15:37281127-37281149 GCCATTCTGTGTCTTTTAATTGG + Intergenic
1125286390 15:38097249-38097271 ACCAGTCTGTGTCTTTTAATTGG - Intergenic
1126283612 15:46986289-46986311 ACAACTCTTGGCCTGTTATTGGG + Intergenic
1126784510 15:52165876-52165898 GCCATTCTGTGTCTTTTAATTGG - Intronic
1127003834 15:54542957-54542979 ACCAGTCTGTGTCTTTTAATTGG + Intronic
1127038467 15:54946245-54946267 GCCATTCTGTGTCTTTTAATTGG - Intergenic
1127189354 15:56513484-56513506 GCCATTCTGTGTCTTTTAATTGG + Intergenic
1128856899 15:71025544-71025566 GCCATTCTGTGTCTTTTAATTGG - Intronic
1129332568 15:74835373-74835395 AGAATTCTGGCTCTGCTACTTGG - Intergenic
1131312961 15:91307260-91307282 TCAGTTCTTGGTCAGTTAATGGG + Intergenic
1131463312 15:92635371-92635393 CCACTGCTGGGTGTGTTAATAGG + Intronic
1133699968 16:8299699-8299721 ACAGTTCTAGGTATGTTAATTGG - Intergenic
1134312700 16:13090754-13090776 CCAAGTCTGTGTCTTTTAATTGG + Intronic
1135897530 16:26421423-26421445 GCAAGTCTGTGTCTTTTAATTGG - Intergenic
1140182479 16:72734487-72734509 GCCATTCTGGGTCTTTTAATCGG + Intergenic
1140669863 16:77267693-77267715 GCCATTCTGTGTCTTTTAATTGG + Intronic
1143738187 17:8929244-8929266 ACAAATCTCTGTCTTTTAATTGG - Intronic
1144121034 17:12152641-12152663 GCCATTCTGTGTCTTTTAATTGG - Intergenic
1144432006 17:15200735-15200757 GCCATTCTGTGTCTTTTAATTGG - Intergenic
1146758819 17:35457719-35457741 GCCATTCTGTGTCTTTTAATTGG + Intergenic
1149727353 17:58909829-58909851 AGATTTCTGGGTCTGTGATTTGG + Intronic
1149888179 17:60361589-60361611 ACAATTGTGGGAATGTAAATTGG - Intronic
1150518102 17:65836323-65836345 GCCATTCTGTGTCTTTTAATTGG - Intronic
1151063683 17:71126107-71126129 ACTATTCAGGGTATGTTAAGGGG + Intergenic
1151108310 17:71644970-71644992 GCCATTCTGTGTCTTTTAATTGG - Intergenic
1152033129 17:77855921-77855943 CCAGTTCTGGGTCTGTTCTTGGG + Intergenic
1153790731 18:8577181-8577203 ACCAGTCTGTGTCTTTTAATTGG + Intergenic
1153858096 18:9171384-9171406 GCCATTCTGTGTCTTTTAATTGG + Intronic
1154444783 18:14426871-14426893 GCAAGTCTGTGTCTTTTAATTGG + Intergenic
1155132991 18:22956689-22956711 GCAATTCTTAGTATGTTAATGGG + Intronic
1155842325 18:30660865-30660887 GCTATTCTGTGTCTTTTAATTGG - Intergenic
1155940709 18:31799606-31799628 ACAGCTCTTGGTCTGTTACTGGG + Intergenic
1156138928 18:34081072-34081094 ACAATTGTGAATCTGTAAATAGG - Intronic
1156207031 18:34896950-34896972 ACCAGTCTGTGTCTTTTAATTGG - Intergenic
1156643177 18:39126653-39126675 GCCATTCTGTGTCTTTTAATTGG - Intergenic
1157218780 18:45808924-45808946 GCAATTCTGTGTCTTTTAAGTGG - Intergenic
1157341204 18:46780035-46780057 ACAACTCTTGGCCTGTTACTGGG + Intergenic
1158074599 18:53513496-53513518 GCCATTCTGTGTCTTTTAATTGG - Intronic
1158319330 18:56246135-56246157 AGAATTTTTGGTCTGTGAATTGG - Intergenic
1158659123 18:59369952-59369974 ACCAGTCTGTGTCTTTTAATTGG + Intergenic
1159281698 18:66293975-66293997 ACTAGTCTGTGTCTTTTAATTGG - Intergenic
1159387483 18:67744176-67744198 GCCATTCTGTGTCTTTTAATTGG - Intergenic
1159711302 18:71764132-71764154 ACAACTCTTGGTTTGTTACTGGG + Intronic
1164058928 19:21648317-21648339 GCCATTCTGTGTCTTTTAATTGG + Intergenic
1164117256 19:22234566-22234588 ACAACTCTTGGCCTGTTACTGGG - Intergenic
1164299025 19:23942901-23942923 GCAGTTCTGTGTCTTTTAATTGG + Intronic
1166262923 19:41654593-41654615 ACAATTCTGTGTCTTTTAAGTGG - Intronic
1166442509 19:42827190-42827212 GCAATTCTGTGTCTTTTAAGTGG + Intronic
1166489432 19:43246010-43246032 ACCAGTCTGTGTCTTTTAATTGG + Intronic
1168458227 19:56532063-56532085 ACAGTTCTGTGTCTTTTAAGTGG + Intergenic
925803919 2:7629820-7629842 ACAATTCTGGGTATTTTTGTGGG + Intergenic
926454101 2:13042467-13042489 GCTATTCTGTGTCTTTTAATTGG - Intergenic
927390693 2:22591470-22591492 GCCATTCTGGGGCTTTTAATTGG - Intergenic
927607131 2:24495607-24495629 AGAATTCTGGTCCTGATAATGGG - Intronic
928303943 2:30150069-30150091 ACAGTTCTGGGTCTTAAAATAGG - Intronic
928475983 2:31628429-31628451 CCAACTCTGTGTCTATTAATTGG + Intergenic
928945743 2:36770488-36770510 ACATTTATGGGTCAGTTAAGGGG - Intronic
929550263 2:42886040-42886062 ACAACTCTTGGACTGTTACTGGG + Intergenic
930801202 2:55444272-55444294 ACCAGTCTGTGTCTTTTAATTGG - Intergenic
930948297 2:57104190-57104212 GCCATTCTGTGTCTTTTAATTGG + Intergenic
931130346 2:59328476-59328498 ACCAGTCTGTGTCTTTTAATTGG - Intergenic
931136170 2:59403835-59403857 ACAATTCTGTGTCTTTTAAGTGG - Intergenic
932379867 2:71272121-71272143 GCCATTCTGTGTCTTTTAATTGG - Intergenic
932925649 2:75970628-75970650 GCCATTCTGTGTCTTTTAATTGG - Intergenic
933110578 2:78395381-78395403 ACCACTCTGTGTCTTTTAATTGG + Intergenic
933359125 2:81255576-81255598 ACCATTCTATGTCTTTTAATTGG + Intergenic
933404602 2:81842098-81842120 ACCAGTCTGTGTCTTTTAATTGG - Intergenic
933880639 2:86665867-86665889 GCCAGTCTGGGTCTTTTAATTGG - Intronic
934015522 2:87877161-87877183 GCCATTCTGTGTCTTTTAATTGG + Intergenic
934715968 2:96543732-96543754 ACCATTGTAGGACTGTTAATTGG - Intronic
935526640 2:104178705-104178727 ACCATTCTATGTCTTTTAATTGG + Intergenic
938230437 2:129654478-129654500 ACAGGTCTGGGTCTGTGGATGGG - Intergenic
938748870 2:134309199-134309221 ACCATATTTGGTCTGTTAATTGG + Intronic
939179931 2:138792833-138792855 ACCATTCTGTGTCTTTTAATTGG + Intergenic
939788684 2:146546103-146546125 ACAACTCTTGGCCTGTTACTGGG - Intergenic
939975976 2:148718200-148718222 GCCATTCTGTGTCTTTTAATTGG + Intronic
940257417 2:151745511-151745533 ACCAGTCTGTGTCTTTTAATTGG - Intergenic
940417268 2:153437785-153437807 ACCAGTCTGTGTCTTTTAATTGG + Intergenic
942405445 2:175648824-175648846 TCCATTCTGTGTCTTTTAATTGG - Intergenic
942728888 2:179041598-179041620 GCCATTCTGTGTCTTTTAATTGG - Intronic
943056794 2:182991847-182991869 TCATTTTTGGGTCTGTTGATTGG - Intronic
943204894 2:184881974-184881996 ACAATTTTGTGCCTTTTAATTGG - Intronic
943239217 2:185362562-185362584 ACAACTCTTGGCCTGTTACTGGG - Intergenic
943317927 2:186412309-186412331 ACAGCTCTTGGTCTGTTACTGGG - Intergenic
943698197 2:190959379-190959401 GCCATTCTGTGTCTTTTAATTGG + Intronic
943855517 2:192784880-192784902 AGAATTCTGTGTGTGTTAATGGG + Intergenic
943904664 2:193483539-193483561 ACCATTCTGATTCTGTTTATAGG + Intergenic
944439191 2:199725344-199725366 GCCATTCTGTGTCTTTTAATTGG + Intergenic
944918273 2:204383722-204383744 GCCATTCTGTGTCTTTTAATTGG + Intergenic
945024067 2:205603805-205603827 GCCATTCTGTGTCTTTTAATTGG + Intronic
945161652 2:206898174-206898196 GCCATTCTGTGTCTTTTAATTGG + Intergenic
945524196 2:210867815-210867837 GCCATTCTGTGTCTTTTAATTGG - Intergenic
945742196 2:213677300-213677322 ACCAGTCTGTGTCTTTTAATTGG - Intronic
946166733 2:217869101-217869123 ACAGTTCTGAGGCTGTTTATGGG - Intronic
946786011 2:223245474-223245496 GCCATTCTGTGTCTTTTAATTGG + Intergenic
946803674 2:223448623-223448645 ACAACTCTGGGTCTTTTATGAGG + Intergenic
947098117 2:226590041-226590063 GCCATTCTGTGTCTTTTAATTGG + Intergenic
948064313 2:235065326-235065348 GCAATTCTGTGCCTGTTTATGGG + Intergenic
948717302 2:239873327-239873349 AAAATTCTGGCTATGTTACTGGG - Intergenic
948970698 2:241423645-241423667 GCCATTCTGTGTCTTTTAATTGG - Intronic
1169283452 20:4287683-4287705 ACCAGTCTGTGTCTTTTAATTGG + Intergenic
1169942554 20:10952805-10952827 ACAATGCTGGTCATGTTAATTGG - Intergenic
1170011685 20:11730180-11730202 GCCATTCTGTGTCTTTTAATTGG - Intergenic
1170807701 20:19647322-19647344 TCAAATCTGGGTCTGTTTCTGGG + Intronic
1171027969 20:21649712-21649734 ACAATTCTGTATCTTTTAAGGGG - Intergenic
1171835875 20:30144787-30144809 ACCAGTCTGTGTCTTTTAATTGG + Intergenic
1173098168 20:40058530-40058552 ATAATTCCTGGTGTGTTAATCGG + Intergenic
1174989688 20:55496435-55496457 GCCAGTCTGGGTCTTTTAATTGG + Intergenic
1175445811 20:59018746-59018768 AGAATTCAGGGTCTGGTAAAGGG + Intergenic
1176451203 21:6862999-6863021 GCAAGTCTGTGTCTTTTAATTGG - Intergenic
1176738117 21:10571493-10571515 TAAATTTAGGGTCTGTTAATGGG - Intronic
1176829372 21:13728050-13728072 GCAAGTCTGTGTCTTTTAATTGG - Intergenic
1176982730 21:15401635-15401657 ACAATTCTGGGACTATTGAATGG + Intergenic
1177111686 21:17036286-17036308 GCCATTCTGTGTCTTTTAATTGG - Intergenic
1178060753 21:28851128-28851150 ACAGTTCTTGGCCTGTTACTGGG - Intergenic
1180250150 21:46580403-46580425 GCCATTCTGTGTCTTTTAATTGG + Intergenic
1180899492 22:19360208-19360230 TCATTTCTGGGTCTGTGAAGGGG - Intronic
1181908574 22:26219666-26219688 AAAGTTCTGGGTATGTGAATAGG + Intronic
1184731621 22:46373861-46373883 ACGCTTCTGTGTCTGTTAAAGGG - Intronic
949245870 3:1924932-1924954 ACAGCTCTTGGTCTGTTACTGGG + Intergenic
950134464 3:10570978-10571000 AAAATTCTGGGTCAGTGAGTTGG + Intronic
950599027 3:14015375-14015397 GCAATTCTGTGTCTTTTAAGTGG + Intronic
950781371 3:15395458-15395480 GCCACTCTGGGTCTTTTAATTGG + Intronic
951368499 3:21814382-21814404 ACCAGTCTGTGTCTTTTAATTGG - Intronic
951921085 3:27854634-27854656 GCTATTCTGTGTCTTTTAATTGG - Intergenic
951970761 3:28441856-28441878 ACAGCTCTTGGTCTGTTACTGGG - Intronic
952073920 3:29672469-29672491 GCAAGTCTGTGTCTTTTAATTGG - Intronic
952993900 3:38858211-38858233 ACAATTCTATGTCTTTTAAATGG - Intronic
954491319 3:50909172-50909194 GCCATTCTGTGTCTTTTAATTGG + Intronic
954507928 3:51095118-51095140 ACCAGTCTGTGTCTTTTAATTGG + Intronic
955681135 3:61503369-61503391 GCCATTCTGTGTCTTTTAATTGG + Intergenic
955854445 3:63257751-63257773 ACCAGTCTGTGTCTTTTAATTGG - Intronic
956032659 3:65055899-65055921 GCCATTCTGTGTCTTTTAATTGG - Intergenic
956374981 3:68604334-68604356 GCCATTCTGTGTCTTTTAATTGG - Intergenic
956386272 3:68723341-68723363 GCCATTCTGTGTCTTTTAATTGG + Intergenic
956461668 3:69479165-69479187 GCCAGTCTGGGTCTTTTAATTGG + Intronic
957689901 3:83554204-83554226 GCCATTCTGTGTCTTTTAATTGG + Intergenic
957776725 3:84763196-84763218 CCCAGTCTGGGTCTTTTAATTGG - Intergenic
957811401 3:85227594-85227616 GCCATTCTGTGTCTTTTAATTGG + Intronic
958650286 3:96929191-96929213 GCCATTCTGTGTCTTTTAATCGG + Intronic
958759398 3:98289916-98289938 GCCATTCTGTGTCTTTTAATTGG + Intergenic
958815396 3:98908656-98908678 GCCATTCTGTGTCTTTTAATTGG - Intergenic
959883312 3:111471829-111471851 GCCATTCTGTGTCTTTTAATTGG + Intronic
959898229 3:111629196-111629218 GCCATTCTGTGTCTTTTAATTGG - Intronic
960349531 3:116575710-116575732 ACAGCTCTTGGTCTGTTACTGGG + Intronic
960567880 3:119154792-119154814 GCCATTCTGTGTCTTTTAATGGG + Intronic
960764388 3:121110165-121110187 GCCATTCTGTGTCTTTTAATTGG + Intronic
962639917 3:137375257-137375279 GCCATTCTGTGTCTTTTAATTGG + Intergenic
962696693 3:137955449-137955471 ACCATTCTGTGTCTTTTAATTGG - Intergenic
962831503 3:139146139-139146161 ACCAGTCTGTGTCTTTTAATTGG + Intronic
962833956 3:139170430-139170452 ACCAGTCTGTGTCTTTTAATTGG + Intronic
962880116 3:139569301-139569323 ACCAGTCTGTGTCTTTTAATTGG + Intronic
963416054 3:144997213-144997235 GCTATTCTGTGTCTTTTAATTGG + Intergenic
964294935 3:155223617-155223639 GCCATTCTGTGTCTTTTAATTGG + Intergenic
964433300 3:156626988-156627010 ACTATTCTGGGCTTCTTAATGGG - Intergenic
964519614 3:157550101-157550123 GCTATTCTGTGTCTTTTAATTGG + Intronic
965251331 3:166348258-166348280 ACAGCTCTTGGTCTGTTACTGGG - Intergenic
965343077 3:167513643-167513665 GCCATTCTGTGTCTTTTAATTGG - Intronic
965855873 3:173087481-173087503 GCTATTCTGTGTCTTTTAATTGG + Intronic
965954011 3:174346150-174346172 ACATTTCTGGGAATGTTAAATGG - Intergenic
966080802 3:175997650-175997672 GCAATTCTCTGTCTTTTAATTGG - Intergenic
966445695 3:179998568-179998590 ACAGCTCTTGGTCTGTTACTGGG + Intronic
968696362 4:2031300-2031322 CCCATTCTGTGTCTTTTAATTGG + Intronic
970298161 4:14653600-14653622 AGAGTTCTGTGTCTGTTAATAGG + Intergenic
970685455 4:18561567-18561589 ACCAGTCTGTGTCTTTTAATTGG - Intergenic
970689562 4:18606937-18606959 ACTCTTCTGGGTTTGTTAATTGG + Intergenic
971106760 4:23534220-23534242 ACCATTATGGGTTTGTTAATTGG + Intergenic
971590016 4:28455654-28455676 GCAACTCTGTGTCTTTTAATGGG + Intergenic
971670432 4:29548236-29548258 ACAAGTCTGGGAGGGTTAATTGG - Intergenic
971683806 4:29738000-29738022 ACAATTCAGGGTGAGTTTATTGG - Intergenic
971841419 4:31857195-31857217 ACCATTCTGAGTCTTTTAAATGG - Intergenic
972116174 4:35637059-35637081 ACAATGCTGGGAGTGTAAATTGG + Intergenic
972861197 4:43170797-43170819 GCTATTCTGTGTCTTTTAATTGG - Intergenic
972984550 4:44747950-44747972 ACCAGTCTGTGTCTTTTAATTGG + Intergenic
972989969 4:44812864-44812886 GCCATTCTGGGTCTTTTAATTGG + Intergenic
973564340 4:52169172-52169194 ACCAGTCTGTGTCTTTTAATTGG + Intergenic
974176860 4:58335497-58335519 ACGAGTCTGTGTCTTTTAATTGG - Intergenic
974427375 4:61758638-61758660 ACCAGTCTGTGTCTTTTAATGGG + Intronic
974560293 4:63508139-63508161 ACCAGTCTGTGTCTTTTAATTGG - Intergenic
974723065 4:65767175-65767197 ACAACTCTGTGCCTTTTAATTGG + Intergenic
974746913 4:66088896-66088918 ACAGCTCTTGGTCTGTTACTGGG - Intergenic
975018731 4:69460038-69460060 ATATTTCTGGGTTTGTTTATGGG + Intergenic
975153707 4:71047269-71047291 GCCATTCTGTGTCTTTTAATTGG - Intergenic
975404277 4:73971108-73971130 GCCATTCTGGGCCTTTTAATTGG - Intergenic
975490078 4:74978150-74978172 GCCATTCTGTGTCTTTTAATTGG - Intronic
975498084 4:75056337-75056359 ACTGTTCTGGGTTTCTTAATGGG - Intergenic
975806321 4:78116789-78116811 ACCAGTCTGTGTCTTTTAATTGG + Intronic
975977730 4:80117758-80117780 GCCATTCTGTGTCTTTTAATTGG - Intronic
975998463 4:80342858-80342880 GCCATTCTGTGTCTTTTAATTGG - Intronic
976034204 4:80795813-80795835 ACAGATCTTGGTCTGTTAGTGGG - Intronic
976159772 4:82186303-82186325 ACCAGTCTGTGTCTTTTAATTGG - Intergenic
976941936 4:90713101-90713123 GCCATTCTGTGTCTTTTAATTGG + Intronic
977333457 4:95665888-95665910 ACCAGTCTGTGTCTTTTAATTGG - Intergenic
977455861 4:97258768-97258790 ACCAGTCTGTGTCTTTTAATTGG + Intronic
977466003 4:97383383-97383405 ACAACTCTTGGTCTGTTACTGGG + Intronic
977478178 4:97539225-97539247 ACCAGTCTGTGTCTTTTAATTGG - Intronic
977630496 4:99237545-99237567 GCAAGTCTGTGTCTTTTAATTGG + Intergenic
977647108 4:99425242-99425264 ACCAGTCTGTGTCTTTTAATTGG - Intronic
977994681 4:103486940-103486962 ACCAGTCTGTGTCTTTTAATTGG - Intergenic
978328116 4:107581373-107581395 GCCATTCTGTGTCTTTTAATTGG - Intergenic
978430575 4:108628717-108628739 AGAATTCTTGGTATGTTAAATGG + Intronic
978631429 4:110751092-110751114 ACAATGCTGGGACTGAAAATTGG + Intergenic
979042322 4:115813841-115813863 GCCAGTCTGTGTCTGTTAATGGG - Intergenic
979457824 4:120946254-120946276 ACCAGTCTGTGTCTTTTAATTGG - Intergenic
979501125 4:121441245-121441267 GCCATTCTGTGTCTTTTAATTGG + Intergenic
979742626 4:124169682-124169704 GCCATTCTGTGTCTTTTAATTGG - Intergenic
980238039 4:130133682-130133704 GCAATTCTGTATCTTTTAATTGG - Intergenic
980508718 4:133757952-133757974 GCCATTCTGTGTCTTTTAATTGG + Intergenic
980574702 4:134669931-134669953 ACAATACTGTGTCTGTAAAATGG - Intergenic
980746508 4:137023741-137023763 ACAATTGTCGTTCTGTAAATTGG + Intergenic
981479810 4:145227036-145227058 ACCAGTCTGTGTCTTTTAATTGG + Intergenic
981796096 4:148597229-148597251 ACTAGTCTGTGTCTTTTAATTGG + Intergenic
981835559 4:149049389-149049411 AGAATTCTGGGTCTTTCCATTGG + Intergenic
982060044 4:151595981-151596003 GCAAGTCTGTGTCTTTTAATTGG + Intronic
982372527 4:154649076-154649098 GCTATTCTGTGTCTTTTAATTGG - Intronic
982485042 4:155956271-155956293 AGAATTTTGGGTCAGTTAAAAGG + Intergenic
982579633 4:157161289-157161311 ACCAGTCTGTGTCTTTTAATTGG + Intronic
982580976 4:157178847-157178869 ACCAGTCTGTGTCTTTTAATTGG + Intergenic
982789180 4:159571269-159571291 GCCTTTCTGTGTCTGTTAATTGG + Intergenic
982859615 4:160432914-160432936 GCCATTCTGTGTCTTTTAATTGG + Intergenic
982903363 4:161036416-161036438 GCCACTCTGTGTCTGTTAATTGG - Intergenic
983341119 4:166462591-166462613 ACAATTCTGTGTAAGTGAATTGG + Intergenic
983392157 4:167145993-167146015 ACCAGTCTGTGTCTTTTAATTGG - Intronic
983596083 4:169470086-169470108 GCCAGTCTGGGTCTTTTAATTGG + Intronic
983680723 4:170350580-170350602 AAAATTCTGCTTCTGTTCATAGG - Intergenic
983828861 4:172300329-172300351 ACCAGTCTGTGTCTTTTAATTGG + Intronic
984076162 4:175182858-175182880 GCCATTCTGTGTCTTTTAATTGG + Intergenic
984215978 4:176912883-176912905 ACCAGTCTGTGTCTTTTAATTGG - Intergenic
985345384 4:188999529-188999551 GCCATTCTGTGTCTTTTAATGGG + Intergenic
986120238 5:4828514-4828536 ACAATTGTGGGCCTGTTGTTAGG + Intergenic
986452542 5:7880886-7880908 ACATTCCAGGGTCTGTTAAGAGG - Intronic
986726005 5:10597224-10597246 GCTATTCTGTGTCTTTTAATTGG - Intronic
986753767 5:10814146-10814168 TCCATTCTGTGTCTTTTAATTGG - Intergenic
986877369 5:12127830-12127852 GCAAGTCTGTGTCTTTTAATTGG - Intergenic
986907368 5:12511574-12511596 ACCATTCTGTGTCTTTTAATTGG + Intergenic
986915241 5:12611883-12611905 GCTATTCTGTGTCTTTTAATTGG + Intergenic
986959619 5:13197675-13197697 GCATTTCTGGGTCTGTAAACTGG - Intergenic
987598717 5:20037073-20037095 GCAAGTCTGTGTCTTTTAATTGG + Intronic
987635005 5:20527944-20527966 GCCATTCTGTGTCTTTTAATTGG - Intronic
987837201 5:23177281-23177303 GCCATTCTGTGTCTTTTAATTGG + Intergenic
988079829 5:26401410-26401432 ACAACTCTTGGCCTGTTACTGGG - Intergenic
988251074 5:28758771-28758793 ACCAGTCTGTGTCTTTTAATTGG + Intergenic
988616732 5:32782129-32782151 AGAATTCTGTTTCTCTTAATTGG - Intronic
988887282 5:35572180-35572202 ACCAGTCTGTGTCTTTTAATTGG + Intergenic
989097615 5:37795815-37795837 TCATTTCTGGGTCTGTAAAGTGG - Intergenic
989956734 5:50368929-50368951 ACCAGTCTGTGTCTTTTAATTGG - Intergenic
989977084 5:50600070-50600092 ACCAGTCTGTGTCTTTTAATTGG + Intergenic
990163492 5:52969709-52969731 GCCAGTCTGTGTCTGTTAATTGG + Intergenic
990835811 5:60018522-60018544 GCCATTCTGTGTCTTTTAATTGG - Intronic
991227550 5:64290833-64290855 GCCATTCTGTGTCTTTTAATTGG + Intronic
991346706 5:65676021-65676043 GCCATTCTGTGTCTTTTAATTGG - Intronic
992242957 5:74789877-74789899 ACAGTTCTTGGCCTGTTACTGGG + Intronic
992336280 5:75773509-75773531 ACCAGTCTGTGTCTTTTAATTGG + Intergenic
992977488 5:82136183-82136205 ACCAGTCTGTGTCTTTTAATTGG + Intronic
993043899 5:82846010-82846032 GCCATTCTGAGTCTTTTAATTGG + Intergenic
993375682 5:87147543-87147565 TCCATTCTGTGTCTTTTAATTGG - Intergenic
993895203 5:93525043-93525065 ACCAGTCTGTGTCTTTTAATTGG - Intergenic
993947793 5:94136408-94136430 ACCAGTCTGTGTCTTTTAATTGG + Intergenic
994299013 5:98123577-98123599 GCCATTCTGTGTCTTTTAATTGG - Intergenic
995052447 5:107721409-107721431 CCCATTCTGTGTCTTTTAATTGG - Intergenic
995289893 5:110439796-110439818 AAAATTCTGTGTCTGCGAATGGG - Intronic
995657905 5:114447698-114447720 ACAATTCTGGCTCACTAAATTGG - Intronic
995695032 5:114868942-114868964 GCCATTCTGTGTCTTTTAATTGG - Intergenic
995833452 5:116377982-116378004 ACAACTGAGGCTCTGTTAATAGG + Intronic
996018562 5:118567866-118567888 ACAGCTCTTGGTCTGTTACTGGG + Intergenic
996158322 5:120130830-120130852 GCCATTCTGTGTCTTTTAATTGG + Intergenic
996162217 5:120179993-120180015 GCCATTCTGTGTCTTTTAATTGG + Intergenic
996200687 5:120668413-120668435 GCCATTCTGTGTCTTTTAATTGG + Intronic
996482012 5:123986576-123986598 GCCATTCTGTGTCTTTTAATTGG + Intergenic
996778402 5:127158061-127158083 GCCATTCTGTGTCTTTTAATTGG + Intergenic
996788805 5:127270265-127270287 GCCAGTCTGGGTCTTTTAATTGG - Intergenic
996829929 5:127728729-127728751 GCCATTCTGTGTCTTTTAATTGG - Intergenic
997084864 5:130785639-130785661 GCAAGTCTGTGTCTTTTAATTGG - Intergenic
998541767 5:142989434-142989456 GCAAGTCTGTGTCTTTTAATTGG + Intronic
998803378 5:145893315-145893337 GCCATTCTGTGTCTTTTAATTGG - Intergenic
999677278 5:154016817-154016839 GCAATTCTGTGTCTTTTAAGTGG - Intronic
999938842 5:156518024-156518046 GCTATTCTGTGTCTTTTAATTGG - Intronic
1000557427 5:162743479-162743501 GCTATTCTGTGTCTTTTAATTGG + Intergenic
1000565942 5:162847447-162847469 ACCAGTCTGTGTCTTTTAATTGG - Intergenic
1000591814 5:163167225-163167247 GCAAGTCTGTGTCTTTTAATTGG - Intergenic
1000720110 5:164695105-164695127 GCCATTCTGTGTCTTTTAATTGG - Intergenic
1000749067 5:165072590-165072612 GCCATTCTGTGTCTTTTAATTGG + Intergenic
1001084528 5:168691059-168691081 ACGATTCTGGCTCTGTTGCTGGG - Intronic
1001844251 5:174906577-174906599 GCCATTCTGTGTCTTTTAATTGG - Intergenic
1002967435 6:1980226-1980248 GCCATTCTGTGTCTTTTAATTGG - Intronic
1003085605 6:3058227-3058249 ATAATTTTGGGTTTGGTAATAGG - Intergenic
1007134854 6:39510728-39510750 GCCAGTCTGTGTCTGTTAATTGG - Intronic
1008701634 6:54107430-54107452 TCAATTCTGAGCCTGTGAATCGG + Intronic
1008982266 6:57498513-57498535 ACTATTCTGGTTCTTTGAATAGG + Intronic
1009170332 6:60391339-60391361 ACTATTCTGGTTCTTTCAATAGG + Intergenic
1009186563 6:60581009-60581031 ACCAGTCTGTGTCTTTTAATTGG - Intergenic
1009384658 6:63074222-63074244 GCCATTCTGTGTCTTTTAATTGG + Intergenic
1009943814 6:70319737-70319759 GCCATTCTGTGTCTTTTAATTGG - Intergenic
1010282767 6:74039773-74039795 GCCATTCTGTGTCTTTTAATTGG + Intergenic
1010666965 6:78642336-78642358 ACCAGTCTGTGTCTTTTAATTGG + Intergenic
1010994232 6:82514444-82514466 ACCAGTCTGTGTCTTTTAATTGG - Intergenic
1011081838 6:83497825-83497847 ACCAGTCTGTGTCTTTTAATTGG - Intergenic
1011114578 6:83875849-83875871 CCAAGTCTGGGTCTGTTTAGTGG + Intronic
1011295102 6:85818107-85818129 GCCATTCTGGGTCTTTTAACTGG - Intergenic
1011296617 6:85833334-85833356 GCCATTCTGTGTCTTTTAATTGG + Intergenic
1011298729 6:85851840-85851862 GCCATTCTGTGTCTTTTAATTGG + Intergenic
1011299672 6:85861253-85861275 GCCATTCTGTGTCTTTTAATTGG + Intergenic
1011308579 6:85956864-85956886 GCCATTCTGTGTCTTTTAATTGG + Intergenic
1011377425 6:86704946-86704968 GCCATTCTGTGTCTTTTAATTGG + Intergenic
1011560144 6:88605934-88605956 ACATTGCTGAGTCTGTAAATAGG + Intergenic
1011620233 6:89235678-89235700 ACAATTCTGTATCTTTTAAATGG + Intergenic
1011921239 6:92579388-92579410 ACCATTCTGTGTCTTTTAATTGG - Intergenic
1011992442 6:93539705-93539727 TCCATTCTGTGTCTTTTAATTGG - Intergenic
1012110699 6:95228394-95228416 ACACTTCTGGGTCTTTATATTGG - Intergenic
1012183917 6:96189865-96189887 ACCAGTCTGTGTCTTTTAATTGG + Intronic
1012231904 6:96769639-96769661 GCCATTCTGTGTCTTTTAATTGG - Intergenic
1012317368 6:97796804-97796826 GCCAGTCTGGGTCTTTTAATTGG - Intergenic
1012419180 6:99043970-99043992 GCCATTCTGTGTCTTTTAATTGG + Intergenic
1012484393 6:99704302-99704324 ACCAGTCTGTGTCTTTTAATTGG - Intergenic
1012688554 6:102284458-102284480 GCCATTCTGTGTCTTTTAATTGG - Intergenic
1012786397 6:103633641-103633663 GCAATTCTGTGTCTTTTAAGTGG - Intergenic
1012820806 6:104082929-104082951 ACAGTTCTTGGCCTGTTACTGGG + Intergenic
1012869686 6:104658577-104658599 TCCATTCTGTGTCTTTTAATTGG - Intergenic
1012878249 6:104754970-104754992 GCCATTCTTGGTCTTTTAATTGG - Intronic
1013344705 6:109249183-109249205 ACCAGTCTGTGTCTTTTAATTGG + Intergenic
1013449087 6:110261149-110261171 CCAAGTCTGTGTCTTTTAATTGG - Intronic
1013901683 6:115164620-115164642 ACCAGTCTGTGTCTTTTAATTGG + Intergenic
1013991869 6:116263561-116263583 ACCATTCTGTGTCTTTTAATTGG + Intronic
1014380713 6:120737668-120737690 ACAATTTTAGATTTGTTAATAGG - Intergenic
1014464298 6:121736984-121737006 GCCATTCTGTGTCTTTTAATTGG + Intergenic
1015095448 6:129409590-129409612 ACAACTCTTGGCCTGTTACTGGG - Intronic
1015248688 6:131104301-131104323 ACAATTCTGTGTCAGTAACTGGG - Intergenic
1016153228 6:140770396-140770418 AAAATTCAGGGTTTGTTCATAGG + Intergenic
1016174913 6:141069084-141069106 ACAGTTCTTGGCCTGTTACTGGG - Intergenic
1016335073 6:142995931-142995953 GCCATTCTGTGTCTTTTAATTGG - Intergenic
1016364940 6:143306184-143306206 ACCAGTCTGTGTCTTTTAATTGG + Intronic
1016576256 6:145572576-145572598 ACAGCTCTTGGTCTGTTACTGGG - Intronic
1016655436 6:146513616-146513638 GCCAGTCTGTGTCTGTTAATTGG + Intergenic
1017452019 6:154563179-154563201 AGGATTCTGGGTCTGTAAACTGG - Intergenic
1017977114 6:159368046-159368068 ACAGTTCTTGGTTTGTTACTGGG - Intergenic
1019027038 6:168975947-168975969 TCCAGTCTGGGTCTTTTAATTGG + Intergenic
1020330154 7:7009762-7009784 ACCAGTCTGTGTCTTTTAATTGG + Intergenic
1020599151 7:10250003-10250025 GCCATTCTGTGTCTTTTAATTGG - Intergenic
1020823582 7:13000673-13000695 ACCAGTCTGTGTCTTTTAATTGG + Intergenic
1020874052 7:13672025-13672047 ACTAGTCTGTGTCTTTTAATTGG + Intergenic
1022187481 7:27984133-27984155 ACCAGTCTGTGTCTTTTAATTGG - Intronic
1022401253 7:30040461-30040483 ACAATTCTGGGACTTTTGCTGGG - Intronic
1022406654 7:30096784-30096806 ACCAGTCTGTGTCTTTTAATTGG + Intronic
1023816102 7:43951213-43951235 ACAATTCTGGGTCTGTTAATTGG - Intronic
1024144526 7:46499628-46499650 ACCAGTCTGTGTCTTTTAATTGG - Intergenic
1024495665 7:50042851-50042873 GCCATTCTGTGTCTTTTAATTGG - Intronic
1024590195 7:50874545-50874567 GCAATTCTGTGTCTTTTAATTGG - Intergenic
1024990341 7:55230045-55230067 GCCATTCTGTGTCTTTTAATTGG + Intronic
1025041971 7:55653494-55653516 GCCATTCTGTGTCTTTTAATTGG - Intergenic
1025121948 7:56312504-56312526 ACCAGTCTGTGTCTTTTAATTGG + Intergenic
1025794606 7:64727607-64727629 ACAATTCTGTATCTTTTAAGTGG + Intergenic
1027642270 7:80751127-80751149 ACAATTCTGGGTATTTATATAGG - Intronic
1027660828 7:80986626-80986648 AAATTTCTAGGTCTGTCAATGGG + Intergenic
1028518258 7:91701068-91701090 GCCATTCTGTGTCTTTTAATTGG - Intronic
1028626824 7:92887304-92887326 ACCATTCTGTATCTTTTAATTGG + Intergenic
1029817252 7:103108773-103108795 ACCAGTCTGTGTCTTTTAATTGG - Intronic
1030390998 7:108928974-108928996 GCTATTCTGTGTCTTTTAATTGG + Intergenic
1030457462 7:109793042-109793064 ACAACTCTTGGCCTGTTACTGGG - Intergenic
1031043025 7:116858751-116858773 AAAATTCTGGTGATGTTAATTGG + Intronic
1031096930 7:117431513-117431535 GCCATTCTGTGTCTTTTAATTGG + Intergenic
1031157284 7:118124403-118124425 ACCAGTCTGTGTCTTTTAATTGG - Intergenic
1031699245 7:124902708-124902730 GCCATTCTGTGTCTTTTAATTGG - Intronic
1032312334 7:130800274-130800296 ACCAGTCTGTGTCTTTTAATTGG + Intergenic
1032548965 7:132766708-132766730 ACAATCCTGGGTCAGTGAGTAGG + Intergenic
1033780505 7:144663632-144663654 GCCATTCTGTGTCTTTTAATTGG - Intronic
1034058670 7:148065738-148065760 GCAATTCTGTGTCTTTTAAGTGG + Intronic
1034683003 7:152945266-152945288 ACAATTCTGTGTCTTTTAAGTGG + Intergenic
1035599263 8:887330-887352 GCCAGTCTGTGTCTGTTAATTGG + Intergenic
1035772592 8:2159935-2159957 ACAATTTAGGGTCTGTTTCTTGG + Intronic
1036668967 8:10767236-10767258 ACAATACAGGGTCTGTTTATAGG - Intronic
1036947366 8:13106646-13106668 ACAATTTCTGGTCTGTTAAAAGG - Intronic
1037258056 8:16977798-16977820 ACCAGTCTGTGTCTTTTAATTGG + Intergenic
1037748467 8:21664579-21664601 GAATATCTGGGTCTGTTAATGGG - Intergenic
1039264628 8:35810925-35810947 ACCACTCTGTGTCTTTTAATTGG - Intergenic
1040091796 8:43406587-43406609 GCTATTCTGTGTCTTTTAATTGG + Intergenic
1040369558 8:46756064-46756086 ACCAGTCTGTGTCTTTTAATTGG + Intergenic
1040670914 8:49689645-49689667 ACCATTCTGTATCTTTTAATTGG + Intergenic
1040712677 8:50208519-50208541 ACCATTCTGTGTCTTTTAATTGG + Intronic
1040842088 8:51794843-51794865 GCCATTCTGTGTCTTTTAATTGG - Intronic
1041889610 8:62854654-62854676 GCCATTCTGTGTCTTTTAATTGG + Intronic
1042243230 8:66685850-66685872 GTAATTCTGGGTGTGTTTATTGG + Intronic
1043316297 8:78926487-78926509 GCCAGTCTGTGTCTGTTAATTGG + Intergenic
1043496010 8:80800844-80800866 GCCATTCTGTGTCTTTTAATTGG - Intronic
1043564794 8:81535802-81535824 AGGATTCTGGGTCTGAAAATTGG + Intergenic
1044311766 8:90701607-90701629 GCAATTCGGTGTCAGTTAATGGG + Intronic
1044487149 8:92767113-92767135 ACAGTTCTTGGCCTGTTACTGGG - Intergenic
1045211993 8:100108326-100108348 GCCATTCTGTGTCTTTTAATTGG - Intronic
1045595334 8:103648898-103648920 GCAATTTTGTGTCTTTTAATTGG + Intronic
1045978023 8:108151244-108151266 GCCATTCTGTGTCTTTTAATTGG - Intergenic
1046135041 8:110014901-110014923 GCCATTCTGTGTCTTTTAATTGG + Intergenic
1046251060 8:111632284-111632306 ACCAGTCTGTGTCTTTTAATTGG - Intergenic
1046435889 8:114189148-114189170 GCCAATCTGGGTCTTTTAATTGG - Intergenic
1046639586 8:116712630-116712652 ACAATTCTGAAACTGCTAATAGG + Intronic
1046987076 8:120399675-120399697 GCCATTCTGTGTCTTTTAATTGG - Intronic
1048129300 8:131676243-131676265 ACAATTGTAGGGCTATTAATTGG + Intergenic
1048382402 8:133878455-133878477 GCAAGTCTGTGTCTTTTAATTGG + Intergenic
1048429090 8:134352196-134352218 GCCATTCTGTGTCTTTTAATTGG + Intergenic
1048656552 8:136544218-136544240 TCATCTGTGGGTCTGTTAATGGG - Intergenic
1048682428 8:136858327-136858349 GCCATTCTGTGTCTTTTAATTGG + Intergenic
1050373946 9:4951669-4951691 ACCATTCTGTGTCTTTTAATTGG + Intergenic
1050381375 9:5033923-5033945 ACCAGTCTGTGTCTTTTAATTGG - Intronic
1050440971 9:5663766-5663788 GCCATTCTGTGTCTTTTAATTGG + Intronic
1050577889 9:7017378-7017400 TCAATTCTTGGTCTCTAAATAGG - Intronic
1051003414 9:12313485-12313507 GCCAGTCTGTGTCTGTTAATTGG + Intergenic
1051324547 9:15950806-15950828 ACCAGTCTGTGTCTTTTAATTGG - Intronic
1051458887 9:17291764-17291786 GCCATTCTGTGTCTTTTAATCGG + Intronic
1051778377 9:20660684-20660706 ACTTTTCTGAGTCTGTTACTTGG - Intronic
1051843673 9:21427586-21427608 GCCATTCTGTGTCTTTTAATTGG + Intronic
1051863165 9:21649800-21649822 ACCAGTCTGTGTCTTTTAATTGG + Intergenic
1052373575 9:27692564-27692586 GCCATTCTGTGTCTTTTAATTGG - Intergenic
1052515107 9:29470707-29470729 GCCATTCTGTGTCTTTTAATTGG + Intergenic
1052895471 9:33743609-33743631 ACAATTCTTGGTCTGCTACTGGG - Intergenic
1054339523 9:63845536-63845558 ACCAGTCTGTGTCTTTTAATTGG - Intergenic
1054938991 9:70719571-70719593 TCCATTCTGTGTCTTTTAATTGG - Intronic
1054940682 9:70737564-70737586 TCCATTCTGTGTCTTTTAATTGG - Intronic
1055175254 9:73311069-73311091 ACAAGTCTGTGTCTTTTAATCGG - Intergenic
1055628970 9:78203105-78203127 ACCAGTCTGTGTCTTTTAATTGG - Intergenic
1055905611 9:81290713-81290735 ACAATTCTGTATCTTTTAAGTGG + Intergenic
1056015201 9:82378048-82378070 GCCATTCTGTGTCTTTTAATGGG - Intergenic
1056996948 9:91471662-91471684 CCAAGTCTGTGTCTTTTAATTGG + Intergenic
1057545082 9:96013439-96013461 AAGATTCTAGGTTTGTTAATAGG + Intronic
1058818572 9:108708421-108708443 ACTATTCTGGCTCTTTTCATAGG - Intergenic
1059895353 9:118857773-118857795 GCCATTCTGTGTCTTTTAATTGG - Intergenic
1062709106 9:137963339-137963361 GCCATTCTGCGTCTTTTAATTGG + Intronic
1203517978 Un_GL000213v1:21518-21540 GCAAGTCTGTGTCTTTTAATTGG + Intergenic
1203447268 Un_GL000219v1:69322-69344 GCCATTCTGTGTCTTTTAATTGG + Intergenic
1186247885 X:7633522-7633544 CCCATTCTGTGTCTTTTAATTGG - Intergenic
1186593462 X:10955121-10955143 GCCATTCTGTGTCTTTTAATTGG - Intergenic
1186913160 X:14191722-14191744 GCCATTCTGTGTCTTTTAATTGG + Intergenic
1188738609 X:33749344-33749366 ACCACTCTGTGTCTTTTAATTGG + Intergenic
1189154882 X:38746713-38746735 ACAGTTCTTGGCCTGTTACTGGG - Intergenic
1189243612 X:39544588-39544610 ACCATTCTGTGTCTTTTAATTGG - Intergenic
1189652112 X:43201766-43201788 GCCATTCTGTGTCTTTTAATTGG + Intergenic
1189682106 X:43527437-43527459 ACATTTCAGGGTCTGTTTCTGGG - Intergenic
1190552894 X:51603052-51603074 ACCATTCTGGGTAGGTTATTTGG - Intergenic
1191020027 X:55849721-55849743 GCAAGTCTGGGTCTTTTAATTGG + Intergenic
1191099419 X:56709688-56709710 GCCATTCTGTGTCTTTTAATTGG + Intergenic
1191766351 X:64703168-64703190 GCCATTCTGTGTCTTTTAATTGG + Intergenic
1191907183 X:66106260-66106282 GCCATTCTGTGTCTTTTAATTGG + Intergenic
1191918965 X:66233393-66233415 ACAATTCTGGGTCTGTGAGGAGG + Intronic
1192303087 X:69927111-69927133 ACCAGTCTGTGTCTTTTAATTGG + Intronic
1192674825 X:73184879-73184901 TCCATTCTGTGTCTTTTAATTGG - Intergenic
1192931236 X:75808762-75808784 GCCATTCTGTGTCTTTTAATTGG + Intergenic
1192977441 X:76301371-76301393 GCCATTCTGTGTCTTTTAATTGG + Intergenic
1192994207 X:76494826-76494848 GCAAGTCTGTGTCTTTTAATTGG - Intergenic
1193031078 X:76898687-76898709 ACCATTGTGTGTCTTTTAATTGG - Intergenic
1193058880 X:77183784-77183806 GCCATTCTGTGTCTTTTAATTGG - Intergenic
1193059198 X:77186634-77186656 ACCATTCTGTGTCTTTTAATTGG - Intergenic
1193079571 X:77392375-77392397 GCCATTCTGTGTCTTTTAATTGG - Intergenic
1193164071 X:78261993-78262015 ACCCTTCTGTGTCTTTTAATTGG + Intergenic
1193190151 X:78561707-78561729 GCCATTCTGTGTCTTTTAATTGG + Intergenic
1193274310 X:79568424-79568446 ACTACTCTGTGTCTTTTAATTGG + Intergenic
1193297782 X:79852681-79852703 ACAGTTCTTGGCCTGTTACTGGG + Intergenic
1193356257 X:80523130-80523152 ACAACTCTTGGCCTGTTACTGGG + Intergenic
1193387769 X:80891575-80891597 GCCATTCTGTGTCTTTTAATTGG + Intergenic
1193612847 X:83653530-83653552 GCCATTCTGTGTCTTTTAATTGG + Intergenic
1193637497 X:83970028-83970050 GCCATTCTGTGTCTTTTAATTGG - Intergenic
1194132898 X:90104444-90104466 GCAAGTCTGTGTCTTTTAATTGG + Intergenic
1194144840 X:90248969-90248991 GCCATTCTGAGTCTTTTAATTGG - Intergenic
1194179589 X:90695928-90695950 ACAACTCTTGGCCTGTTACTGGG - Intergenic
1194208304 X:91038124-91038146 ACCAGTCTGTGTCTTTTAATTGG + Intergenic
1194281157 X:91956211-91956233 GCCATTCTGTGTCTTTTAATTGG + Intronic
1194506209 X:94737106-94737128 ATCATTCTGTGTCTTTTAATTGG + Intergenic
1194849244 X:98852167-98852189 ACAGCTCTTGGTCTGTTACTGGG - Intergenic
1194962560 X:100252244-100252266 GCCATTCTGTGTCTTTTAATTGG - Intergenic
1195787746 X:108546067-108546089 GCCAGTCTGGGTCTTTTAATTGG + Intronic
1195987912 X:110651290-110651312 ACCATTGTGGGTTTATTAATTGG + Intergenic
1196133621 X:112183346-112183368 GCAAGTCTGTGTCTTTTAATTGG - Intergenic
1196229119 X:113201100-113201122 GCTATTCTGTGTCTTTTAATTGG + Intergenic
1196381997 X:115100407-115100429 GCTATTCTGTGTCTTTTAATTGG - Intergenic
1197044416 X:121978332-121978354 ACAACTCTTGGCCTGTTACTGGG + Intergenic
1197272438 X:124439916-124439938 AAAATTCTGTATCTGTAAATGGG - Intronic
1197414273 X:126155006-126155028 GCCAGTCTGGGTCTTTTAATTGG - Intergenic
1197423833 X:126271337-126271359 ACCATTCTGTGTCTTTTATTTGG + Intergenic
1197498492 X:127215923-127215945 GCCAGTCTGGGTCTTTTAATTGG - Intergenic
1197574253 X:128189758-128189780 ACAATTCTGTATCTTTTAAGGGG - Intergenic
1197821037 X:130541075-130541097 ACAATCTTGGGTCTGGCAATGGG - Intergenic
1198166254 X:134060586-134060608 GCCAGTCTGGGTCTTTTAATTGG + Intergenic
1198168578 X:134081638-134081660 GCCAGTCTGGGTCTTTTAATTGG - Intergenic
1198207887 X:134485631-134485653 ATAGTTCTGGGTCTGTTTCTGGG + Intronic
1198645276 X:138800032-138800054 GCGAGTCTGTGTCTGTTAATTGG + Intronic
1198926566 X:141803197-141803219 GCCAGTCTGGGTCTTTTAATTGG + Intergenic
1199040593 X:143111107-143111129 ACAGCTCTTGGTCTGTTACTGGG + Intergenic
1199128960 X:144161350-144161372 GCCATTCTGTGTCTTTTAATTGG - Intergenic
1199376108 X:147111090-147111112 CCCATTCTGTGTCTTTTAATTGG - Intergenic
1199378949 X:147145969-147145991 ACCAGTCTGTGTCTTTTAATTGG + Intergenic
1200355503 X:155545934-155545956 ACAATTATGGGTCAGTTGACAGG - Intronic
1200372544 X:155742028-155742050 GCCATTCTGTGTCTTTTAATTGG - Intergenic
1200478688 Y:3674524-3674546 GCAAGTCTGTGTCTTTTAATTGG + Intergenic
1200490598 Y:3818273-3818295 GCCATTCTGAGTCTTTTAATTGG - Intergenic
1200526251 Y:4278097-4278119 ACAACTCTTGGCCTGTTACTGGG - Intergenic
1200598751 Y:5180875-5180897 GCCATTCTGTGTCTTTTAATTGG + Intronic
1201328063 Y:12787532-12787554 ATAATTCTGGGTTTGTTTCTTGG + Intronic
1201491865 Y:14550337-14550359 TCCATTCTGTGTCTTTTAATTGG + Intronic
1201522056 Y:14886494-14886516 GCCAGTCTGGGTCTCTTAATTGG + Intergenic
1201633927 Y:16100781-16100803 GCCATTCTGTGTCTTTTAATTGG - Intergenic
1201993002 Y:20049561-20049583 GCCATTCTGTGTCTTTTAATTGG - Intergenic
1202020610 Y:20461232-20461254 GCTAGTCTGGGTCTTTTAATAGG + Intergenic
1202241672 Y:22777244-22777266 GCCAGTCTGTGTCTGTTAATTGG + Intergenic
1202250977 Y:22872585-22872607 GCCAGTCTGTGTCTGTTAATTGG - Intergenic
1202359749 Y:24095396-24095418 ACAACTCTTGGCCTGTTACTGGG + Intergenic
1202394655 Y:24410988-24411010 GCCAGTCTGTGTCTGTTAATTGG + Intergenic
1202403966 Y:24506334-24506356 GCCAGTCTGTGTCTGTTAATTGG - Intergenic
1202466813 Y:25163748-25163770 GCCAGTCTGTGTCTGTTAATTGG + Intergenic
1202476129 Y:25259104-25259126 GCCAGTCTGTGTCTGTTAATTGG - Intergenic
1202511029 Y:25574718-25574740 ACAACTCTTGGCCTGTTACTGGG - Intergenic
1202596370 Y:26544789-26544811 TAAATTTAGGGTCTGTTAATGGG - Intergenic