ID: 1023816115

View in Genome Browser
Species Human (GRCh38)
Location 7:43951265-43951287
Sequence CCACATGCACTGTAGCATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 113}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023816103_1023816115 17 Left 1023816103 7:43951225-43951247 CCCAGAATTGTAAAATTCCGACC 0: 1
1: 0
2: 0
3: 4
4: 66
Right 1023816115 7:43951265-43951287 CCACATGCACTGTAGCATGAGGG 0: 1
1: 0
2: 0
3: 13
4: 113
1023816111_1023816115 -7 Left 1023816111 7:43951249-43951271 CCTAGGCCAGGCACAACCACATG 0: 1
1: 0
2: 0
3: 25
4: 238
Right 1023816115 7:43951265-43951287 CCACATGCACTGTAGCATGAGGG 0: 1
1: 0
2: 0
3: 13
4: 113
1023816102_1023816115 29 Left 1023816102 7:43951213-43951235 CCAATTAACAGACCCAGAATTGT 0: 1
1: 0
2: 0
3: 33
4: 688
Right 1023816115 7:43951265-43951287 CCACATGCACTGTAGCATGAGGG 0: 1
1: 0
2: 0
3: 13
4: 113
1023816108_1023816115 -4 Left 1023816108 7:43951246-43951268 CCCCCTAGGCCAGGCACAACCAC 0: 1
1: 0
2: 1
3: 15
4: 179
Right 1023816115 7:43951265-43951287 CCACATGCACTGTAGCATGAGGG 0: 1
1: 0
2: 0
3: 13
4: 113
1023816107_1023816115 0 Left 1023816107 7:43951242-43951264 CCGACCCCCTAGGCCAGGCACAA 0: 1
1: 0
2: 2
3: 18
4: 212
Right 1023816115 7:43951265-43951287 CCACATGCACTGTAGCATGAGGG 0: 1
1: 0
2: 0
3: 13
4: 113
1023816110_1023816115 -6 Left 1023816110 7:43951248-43951270 CCCTAGGCCAGGCACAACCACAT 0: 1
1: 0
2: 1
3: 10
4: 146
Right 1023816115 7:43951265-43951287 CCACATGCACTGTAGCATGAGGG 0: 1
1: 0
2: 0
3: 13
4: 113
1023816104_1023816115 16 Left 1023816104 7:43951226-43951248 CCAGAATTGTAAAATTCCGACCC 0: 1
1: 0
2: 0
3: 4
4: 47
Right 1023816115 7:43951265-43951287 CCACATGCACTGTAGCATGAGGG 0: 1
1: 0
2: 0
3: 13
4: 113
1023816109_1023816115 -5 Left 1023816109 7:43951247-43951269 CCCCTAGGCCAGGCACAACCACA 0: 1
1: 0
2: 2
3: 9
4: 182
Right 1023816115 7:43951265-43951287 CCACATGCACTGTAGCATGAGGG 0: 1
1: 0
2: 0
3: 13
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023816115 Original CRISPR CCACATGCACTGTAGCATGA GGG Intronic
900106220 1:982238-982260 CCTCATGTACTGTAGCTGGAGGG - Intergenic
900974951 1:6011191-6011213 CCACGTGCACAGGAGCAGGAGGG + Intronic
904475541 1:30762383-30762405 CCACAGGCACTGCAGGCTGAAGG + Intergenic
907779300 1:57551179-57551201 CCACGGGCACTGTGGAATGAAGG + Intronic
910376671 1:86579511-86579533 CCTCATGAACTGTGGCATCAAGG - Exonic
911173995 1:94800743-94800765 CCACATGAAGTGCAGCATAATGG - Intergenic
912122665 1:106491846-106491868 CCACATTTACTGTATTATGATGG + Intergenic
917732930 1:177894227-177894249 CCAAATGCAATGTAGCATCCTGG + Intergenic
917771029 1:178278199-178278221 CCACATGTACACTAGCAGGACGG - Intronic
918253427 1:182725181-182725203 CCACATGCCATGTAGCAAGAGGG + Intergenic
919456350 1:197824702-197824724 CCACAGGCACTTGAGCATGCAGG + Intergenic
919764380 1:201116696-201116718 CCACATGCAATGAAGCTTGGTGG - Intronic
920048682 1:203150300-203150322 GCACATGCAGTGGAGCAGGAGGG + Intronic
920067180 1:203277224-203277246 CTCCATGTACTCTAGCATGAAGG - Intergenic
920736620 1:208538649-208538671 CCACAGGCTCTGTGGCCTGACGG + Intergenic
922719800 1:227894473-227894495 CCACATGCACACAACCATGAAGG + Intergenic
1062798866 10:364599-364621 CCACATGAACAGTGGCCTGATGG - Intronic
1067483002 10:46617531-46617553 CCACATGCCCCGCAGCATGTGGG + Intergenic
1067611754 10:47724130-47724152 CCACATGCCCCGCAGCATGTGGG - Intergenic
1071627174 10:87184368-87184390 CCACATGCCCCGCAGCATGTGGG - Intronic
1073803027 10:107064528-107064550 CTACATAAACTGGAGCATGATGG - Intronic
1074285743 10:112096643-112096665 CCACTTGCACTGATGCATTAGGG - Intergenic
1074466277 10:113683768-113683790 CCACATTCACTGTAACATTATGG - Intronic
1080028411 11:27635819-27635841 CCACATGCACCTTAGGAGGATGG - Intergenic
1084160790 11:67348846-67348868 ACACATGCACTGTGACAGGAAGG - Intronic
1085964951 11:81511758-81511780 CCACATTCAATGTAACATGGAGG - Intergenic
1086537360 11:87864053-87864075 CCACATGTATTGTGGCATGTGGG - Intergenic
1089758805 11:120707825-120707847 CCACATGGACTGCTGCATGTGGG + Intronic
1091369104 11:135044058-135044080 GCACATTCACTGAAGCATGGAGG - Intergenic
1092308831 12:7330746-7330768 CCACTTGGACTTCAGCATGAAGG - Intergenic
1099411534 12:82334862-82334884 CCCCATGCAGTGTGGCATCATGG + Intronic
1099569644 12:84300236-84300258 CCACAGGCACTGTATCACCATGG + Intergenic
1100811777 12:98345657-98345679 CCACATGCACACTAGAAGGATGG + Intergenic
1103640874 12:122350972-122350994 CCACATGCACAGAAACATTAAGG + Intronic
1107334846 13:39343981-39344003 CCACGTGCACAGCAGCATGGCGG + Exonic
1110551251 13:76813605-76813627 GCACATGCACTCAAGCATGTGGG + Intergenic
1111620618 13:90720360-90720382 TCACATACACTATAGCATGAAGG + Intergenic
1113058597 13:106296914-106296936 CCACATGCACTGAAACCAGAGGG + Intergenic
1113338904 13:109403046-109403068 CCGCTGGCAGTGTAGCATGACGG - Intergenic
1119910699 14:78346730-78346752 CCACATGTCCTGTGGCATGGAGG - Intronic
1121682401 14:95804526-95804548 CCACATGCTCAGTATCATGCAGG - Intergenic
1132847247 16:2006288-2006310 CCACAATCACTGGAGCAGGAGGG + Intronic
1136238269 16:28928194-28928216 CCACATGCACTCTATCATCAAGG - Intronic
1139154244 16:64421933-64421955 CCACATGCACACTAGGAGGATGG - Intergenic
1141376424 16:83535104-83535126 CCATATACACTGTGGCCTGAAGG + Intronic
1141940666 16:87274009-87274031 CCACATGCTCTGTGGCTTTAGGG - Intronic
1142266997 16:89068597-89068619 CCACATGCACTGTCGTATCAGGG + Intergenic
1143110271 17:4548982-4549004 CAACATGCACGGTTGCAAGAGGG - Intronic
1146681795 17:34813729-34813751 AAACATGCTCTGTAGCATGTAGG + Intergenic
1146949241 17:36894338-36894360 CCTCATGCCCTGAAGCATGAGGG + Intergenic
1152853934 17:82653159-82653181 ACACATGAACTGTTACATGAAGG + Intergenic
1155339344 18:24798341-24798363 GCACATGAACTGGAGCATCATGG + Intergenic
1156304310 18:35862399-35862421 CCACATGCACATTAGGAGGATGG + Intergenic
1158087383 18:53668295-53668317 CCACATGCACTGGGGCCTGCTGG + Intergenic
1160428990 18:78798716-78798738 CCACATTAACTTAAGCATGATGG - Intergenic
1167107344 19:47437965-47437987 CCCCATCCCCTGCAGCATGAGGG + Exonic
1168689161 19:58366571-58366593 CCATCTGCACAGTAGCATGAGGG + Intergenic
926723973 2:15983377-15983399 CCACCTGCTCTGAAGCAGGAAGG + Intergenic
933275332 2:80277946-80277968 CCACATGGACTGAAGGATGGGGG - Intronic
940561740 2:155305556-155305578 TCACAAGAACTGCAGCATGAGGG - Intergenic
941599140 2:167518732-167518754 TCAAATGCACTGTAGCAAGTTGG - Intergenic
943689311 2:190852891-190852913 CCTCATGCCCTGGAGCAGGAGGG + Intergenic
1169803811 20:9539136-9539158 CCACATGCAGGGTAACATGTAGG - Exonic
1173847138 20:46195384-46195406 ACACGTGCTCTGTGGCATGAAGG + Intronic
1174479386 20:50820222-50820244 CCACATACACTGGGGCTTGATGG - Intronic
1178507036 21:33170714-33170736 CCATGTGCACTGTAGCTTAATGG - Intergenic
949684780 3:6556170-6556192 ACACATACACTTTAGCATGGTGG + Intergenic
951350132 3:21596797-21596819 CCAAATCCTCAGTAGCATGAAGG - Intronic
951532902 3:23714341-23714363 CCACATGCACTGCAGCACTAAGG + Intergenic
953968882 3:47331925-47331947 CCATATCCACAGTAGCAGGAGGG + Intronic
955900061 3:63743649-63743671 CAACATGAACTGTTGAATGACGG - Intergenic
958117079 3:89234628-89234650 CTCCAAACACTGTAGCATGATGG - Intronic
958693955 3:97504455-97504477 CCACATGCACACTAGGAGGATGG - Intronic
961548000 3:127649332-127649354 CTACATGGACTGTGCCATGATGG + Intronic
963708768 3:148721776-148721798 CCACATGCACTGAAGCACAAGGG - Intronic
964732608 3:159883343-159883365 CCAGATGCACTGCAGTGTGAGGG + Intronic
966930752 3:184674052-184674074 CCACCTGGACTGGAGCAGGAAGG + Intronic
968381848 4:103191-103213 CAACATGCACTTTATCATGCTGG - Intergenic
969292620 4:6250447-6250469 CCACATGCACAGTAACATATCGG - Intergenic
971070235 4:23082466-23082488 GCACCTGCACTTTAGCAAGATGG + Intergenic
976985693 4:91294007-91294029 CAACATGAAATGTAGAATGAAGG - Intronic
978415082 4:108466324-108466346 CTGCATGCACTGAAGCATGGTGG + Intergenic
980556640 4:134415071-134415093 GCACATACACTGAAACATGATGG - Intergenic
982433092 4:155346130-155346152 GCACATGCACTGCAGCAAGAAGG + Exonic
982861634 4:160458587-160458609 CCCCATACACTGAAGCAAGAGGG + Intergenic
985776479 5:1846702-1846724 ACACACGCACTGTGGCAGGAAGG - Intergenic
986771931 5:10982178-10982200 TCACCTGCACTGAAGCATGCAGG + Intronic
986903751 5:12468351-12468373 ACACATGCACTGTAGCTGGCAGG + Intergenic
989482762 5:41951274-41951296 CCACATGCATTTAAGCAAGATGG - Intergenic
990795769 5:59538797-59538819 GCACATGCTCTGGAGAATGATGG - Intronic
992122151 5:73605832-73605854 CTACATGCAATGTAGCATCCTGG - Intergenic
995670306 5:114595455-114595477 CCACAGCCTCTGAAGCATGATGG + Intergenic
997618079 5:135266336-135266358 TCACATGCACTGTAGCAAGGAGG + Intronic
998093624 5:139384719-139384741 CCAGATCCACAGTAGCATGAAGG + Intergenic
1002475920 5:179466093-179466115 CCGCAGCCACTGAAGCATGAGGG + Intergenic
1004973027 6:20933137-20933159 CCATTAGCAGTGTAGCATGAAGG + Intronic
1006052056 6:31352805-31352827 CCAAATGCACTATGGCAGGAAGG - Intronic
1008921677 6:56849636-56849658 CCACCTGCAGTGTACAATGATGG + Intronic
1010204481 6:73310144-73310166 CCCGAGGCACTGTAGCAGGAGGG + Exonic
1018101632 6:160445782-160445804 GCACAGGCACTGTAGCAGCAAGG + Intronic
1018427406 6:163695810-163695832 CCACAAGCACTGGAGAATGCTGG - Intergenic
1018824195 6:167397161-167397183 CCACACACACAGGAGCATGACGG + Intergenic
1019628248 7:2032366-2032388 CCACCTGCCCGTTAGCATGATGG - Intronic
1019889449 7:3934620-3934642 CCAGATGCTCTGAAGCATGCAGG + Intronic
1022297237 7:29067551-29067573 CCACAGGGACTGCAGCATCAGGG + Intronic
1023816115 7:43951265-43951287 CCACATGCACTGTAGCATGAGGG + Intronic
1026832241 7:73617353-73617375 CCAAAAGGACTGTACCATGAAGG - Intronic
1032121236 7:129158546-129158568 CCACATGTACTTTAGAGTGAAGG - Intronic
1036112570 8:5920122-5920144 CCACATGCACTTTAGGATGGAGG + Intergenic
1040462656 8:47663578-47663600 ACACATGCAGTGAGGCATGAAGG - Intronic
1044710960 8:95057420-95057442 CCAAATGTAGTGTACCATGAGGG - Intronic
1048292917 8:133194176-133194198 CCACATGCACTGATACAGGAGGG - Intronic
1050324881 9:4489742-4489764 CCACAGGCCCTGGAGCATGGAGG - Intergenic
1055641874 9:78325127-78325149 TCACATGCACAGTAGCTTCAGGG + Intronic
1056094011 9:83232690-83232712 CCACATGCTCAGCAGCATGGCGG + Intergenic
1061177349 9:129005734-129005756 CCACATTCACTGTGGCCAGAAGG - Exonic
1061936737 9:133862033-133862055 CCAGGTGCACAGTGGCATGACGG + Intronic
1189634317 X:42988897-42988919 AGACATGCATTGCAGCATGAAGG - Intergenic
1191248664 X:58247985-58248007 CCACAGGCACTCTAACAGGAGGG + Intergenic
1191810735 X:65185163-65185185 CCATATCCATTGTTGCATGATGG - Intergenic
1196069487 X:111504487-111504509 ACATATGCGCTGTGGCATGATGG - Intergenic
1198857500 X:141033455-141033477 CCACATGCACTTGAGCCTGCAGG + Intergenic
1198905196 X:141553916-141553938 CCACATGCACTTGAGCCTGCAGG - Intergenic
1200253771 X:154568472-154568494 CAACATGCCTTGTAGCATGTTGG + Intergenic
1200263998 X:154635936-154635958 CAACATGCCTTGTAGCATGTTGG - Intergenic
1200767559 Y:7093121-7093143 CCACATGCTCTCTAGCCTCAAGG + Intergenic
1200797097 Y:7350755-7350777 CGTCTTGCACTTTAGCATGAAGG - Intergenic