ID: 1023817331

View in Genome Browser
Species Human (GRCh38)
Location 7:43961269-43961291
Sequence TCTACCATGCAGAAAAAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023817324_1023817331 30 Left 1023817324 7:43961216-43961238 CCAGCCTCATTGGTTGTGGAAAG No data
Right 1023817331 7:43961269-43961291 TCTACCATGCAGAAAAAGGTTGG No data
1023817329_1023817331 4 Left 1023817329 7:43961242-43961264 CCAATCAGAGGTACTTTCAATTT 0: 42
1: 124
2: 123
3: 78
4: 239
Right 1023817331 7:43961269-43961291 TCTACCATGCAGAAAAAGGTTGG No data
1023817327_1023817331 26 Left 1023817327 7:43961220-43961242 CCTCATTGGTTGTGGAAAGGGAC No data
Right 1023817331 7:43961269-43961291 TCTACCATGCAGAAAAAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023817331 Original CRISPR TCTACCATGCAGAAAAAGGT TGG Intergenic
No off target data available for this crispr