ID: 1023818641

View in Genome Browser
Species Human (GRCh38)
Location 7:43968390-43968412
Sequence GCCCGGCCACGTGTGTGAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023818633_1023818641 6 Left 1023818633 7:43968361-43968383 CCTGGGAGAAGTGGCCCCGAGGT No data
Right 1023818641 7:43968390-43968412 GCCCGGCCACGTGTGTGAGCGGG No data
1023818628_1023818641 25 Left 1023818628 7:43968342-43968364 CCGTGGGTGACGATGGGTGCCTG No data
Right 1023818641 7:43968390-43968412 GCCCGGCCACGTGTGTGAGCGGG No data
1023818636_1023818641 -9 Left 1023818636 7:43968376-43968398 CCCGAGGTCCCAGAGCCCGGCCA No data
Right 1023818641 7:43968390-43968412 GCCCGGCCACGTGTGTGAGCGGG No data
1023818635_1023818641 -8 Left 1023818635 7:43968375-43968397 CCCCGAGGTCCCAGAGCCCGGCC No data
Right 1023818641 7:43968390-43968412 GCCCGGCCACGTGTGTGAGCGGG No data
1023818637_1023818641 -10 Left 1023818637 7:43968377-43968399 CCGAGGTCCCAGAGCCCGGCCAC No data
Right 1023818641 7:43968390-43968412 GCCCGGCCACGTGTGTGAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023818641 Original CRISPR GCCCGGCCACGTGTGTGAGC GGG Intergenic