ID: 1023821246

View in Genome Browser
Species Human (GRCh38)
Location 7:43981790-43981812
Sequence GAGGGGCCCCGCAGGAGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 422
Summary {0: 3, 1: 0, 2: 4, 3: 55, 4: 360}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023821246_1023821256 5 Left 1023821246 7:43981790-43981812 CCCCTGCTCCTGCGGGGCCCCTC 0: 3
1: 0
2: 4
3: 55
4: 360
Right 1023821256 7:43981818-43981840 TGGCTACTGCCTGCTGATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023821246 Original CRISPR GAGGGGCCCCGCAGGAGCAG GGG (reversed) Intergenic
900127038 1:1073269-1073291 GAGGGCCCAGGCAGGGGCAGGGG + Intronic
900287546 1:1908857-1908879 GAGGGGCCTCTCGGGAGCCGCGG + Intergenic
900296791 1:1955952-1955974 GAGGGGCCACGCTGGAGCCAGGG - Intronic
900349599 1:2228314-2228336 GAGGGGCCCGGGAGGAGCGGGGG - Intergenic
900516691 1:3085557-3085579 GAGAGGCCCAGGAGGAGCCGGGG - Intronic
900586673 1:3435929-3435951 GGGTGGCCCCGCCGGGGCAGCGG + Exonic
901195084 1:7435929-7435951 AAGAGGCACCTCAGGAGCAGAGG + Intronic
903163710 1:21507006-21507028 GAGGGGCACCCGGGGAGCAGGGG + Intergenic
903190052 1:21651311-21651333 GAGGGGCCCAACAGCTGCAGAGG + Intronic
903542526 1:24105075-24105097 GAGGGGCGGGGCAGGGGCAGGGG - Intronic
904045006 1:27603599-27603621 GGGGGGCGCCGCGGGAGCGGGGG - Exonic
904438137 1:30512624-30512646 GCAGGGCCCCGCAGGAGCCAGGG - Intergenic
904442299 1:30539676-30539698 GAGGGGCCCCTTATGACCAGAGG - Intergenic
905242236 1:36588666-36588688 GAGGGACCCAACAGGAGCACAGG - Intergenic
905972687 1:42153623-42153645 GAGGGGCACCGGGGGAGCACGGG + Intronic
907385343 1:54122156-54122178 GAGGGGCACGGCAGGGGTAGTGG - Intergenic
907453915 1:54563069-54563091 GACGGGCCCCGCAGGGCCCGAGG - Intronic
908796298 1:67833571-67833593 TTGTGGCCCCGCAGGAGGAGGGG + Intergenic
910805854 1:91189339-91189361 AACGAGCCCAGCAGGAGCAGGGG + Intergenic
911015064 1:93323367-93323389 TAGAGCCCCAGCAGGAGCAGGGG - Intergenic
911375225 1:97043867-97043889 GAGTGGGCCTGCTGGAGCAGGGG + Intergenic
912793366 1:112674767-112674789 AAGGGAGCCCGCAGGATCAGGGG + Intronic
913163932 1:116168315-116168337 GAGAGGGCGCGCAGGAGCAGCGG + Intergenic
914504976 1:148281091-148281113 GAGAGGCCCCACAGAAGCAGAGG + Intergenic
914507588 1:148303057-148303079 GAGAGGCCCCACAGAAGCAGAGG - Intergenic
914918140 1:151830816-151830838 GTGGGGCCAGGCAGGAGCAAGGG - Intronic
915224479 1:154402477-154402499 GAGGGTCCCTGCAGGAACACCGG + Intergenic
915580384 1:156809569-156809591 GAGGGGCCTAGCGGGGGCAGAGG - Intronic
917854889 1:179092006-179092028 GAGGAGCCCGGCAGGAACAAGGG - Intronic
919513882 1:198497555-198497577 GAGGGTACCAGCAGTAGCAGAGG - Intergenic
919928157 1:202203454-202203476 GAGGGGCACCGCAGCACCAGTGG - Intronic
920879675 1:209867985-209868007 GGGTGGCCCAGCAGGAGCTGTGG - Intergenic
922984562 1:229856354-229856376 GAGGGGGCTGGCAGGACCAGTGG - Intergenic
924052281 1:240091753-240091775 GAGGAGCCGCGCGGGGGCAGAGG + Intronic
1062843081 10:686307-686329 GAGAGGCCCCGCAGGTGGAGAGG - Intronic
1062932606 10:1363003-1363025 GAGGGGCGCGGCGGGTGCAGGGG - Intronic
1063450092 10:6145232-6145254 GAGGGGACACGCAGGACCGGAGG - Intronic
1064112343 10:12550071-12550093 GAGGGGCAGCCCAGGAGGAGAGG + Intronic
1064178396 10:13095327-13095349 CAGTGGCCTCACAGGAGCAGGGG + Intronic
1064195170 10:13238452-13238474 AAGGGGACCGGCAAGAGCAGAGG - Intergenic
1064710238 10:18115821-18115843 GATGGCACCTGCAGGAGCAGTGG - Intergenic
1065188668 10:23192191-23192213 GAGGGGGCCCGGAGGCGCGGCGG - Intergenic
1065917293 10:30364663-30364685 GGGTGGCCAGGCAGGAGCAGGGG - Intronic
1067084163 10:43229427-43229449 GAAGGGCAGGGCAGGAGCAGAGG + Intronic
1067142351 10:43667992-43668014 GAGGGGCCCCGCTTGCGCAGGGG + Intergenic
1067247646 10:44559717-44559739 GAGTGGCCCAGGAGGAGAAGGGG - Intergenic
1069589991 10:69635625-69635647 GGGTGGCCCCGCAGAGGCAGTGG - Intergenic
1071249324 10:83801018-83801040 CAGGGGCTGAGCAGGAGCAGGGG - Intergenic
1072564684 10:96607720-96607742 GAGAGGCCCCGGAGGATGAGAGG + Intronic
1073173883 10:101538331-101538353 GAGTGTCCCTGCAGGAGCACGGG - Exonic
1073253360 10:102135306-102135328 GAGAGGACACGCTGGAGCAGAGG + Intronic
1074186063 10:111100360-111100382 GAGGGGCACTGCAGGAGCAAAGG + Intergenic
1074878875 10:117636061-117636083 GTGGGGCTTCCCAGGAGCAGAGG - Intergenic
1075273809 10:121076035-121076057 GAAGGGCTGGGCAGGAGCAGAGG + Intergenic
1075597609 10:123743602-123743624 GAGCAGCCCCGCAGGAGGAGTGG + Intronic
1076595107 10:131620395-131620417 GAGGGGCCCTGCAGCTGCAGAGG + Intergenic
1076782108 10:132730178-132730200 GGAGGGCCCCGCAGGGGCTGAGG - Intronic
1076884821 10:133257526-133257548 GAGAGGCCCGGAGGGAGCAGGGG - Intergenic
1077080216 11:721706-721728 GACGGGGCCGGCAGGTGCAGGGG + Intronic
1077080224 11:721728-721750 GACGGGGCCAGCAGGTGCAGGGG + Intronic
1077106876 11:845995-846017 CTGGGGCCCCGCAGGGGCTGAGG + Intronic
1077130229 11:968362-968384 CTGGGGTCCCGCGGGAGCAGAGG + Intronic
1077293991 11:1815477-1815499 GAAGGGCCCCATGGGAGCAGGGG + Intergenic
1078164473 11:8870798-8870820 GGGGGCCGCCGCAGGCGCAGAGG - Intronic
1078349643 11:10581932-10581954 CAGGGTCAGCGCAGGAGCAGAGG + Exonic
1079130357 11:17743701-17743723 GAAGGGAGCCGCAGGAGCTGTGG - Intronic
1081807697 11:45899456-45899478 GAGGGGGCCTGAAGGATCAGGGG + Intronic
1083269246 11:61562989-61563011 AGGGGGTGCCGCAGGAGCAGTGG + Intronic
1083594217 11:63911396-63911418 GAGGGGCCTTACAGCAGCAGAGG - Exonic
1084490598 11:69476315-69476337 GAGGGGCCAGGCAGGAGCCAAGG - Intergenic
1084544823 11:69810016-69810038 GAGGAGCCTCCCAGGAGCAGCGG - Intergenic
1088604523 11:111514983-111515005 GCGCGGCCCAGGAGGAGCAGAGG + Exonic
1089213683 11:116822816-116822838 GAGGGGCCACACAGGAGACGGGG - Intronic
1089310448 11:117555031-117555053 AGGGGGCCCAGCATGAGCAGAGG - Intronic
1089500571 11:118929283-118929305 GAGGGGGCCGGCTGGGGCAGGGG + Intronic
1091312503 11:134584784-134584806 GAGAGGGCCGGCAGGTGCAGAGG - Intergenic
1091487656 12:905430-905452 AAGGGGCCTCGCAGCATCAGGGG + Intronic
1091638594 12:2216569-2216591 GAAGGGCCCCCCAGAAGAAGAGG + Intronic
1091795339 12:3294691-3294713 GCCGGGCCCCCCTGGAGCAGGGG - Intergenic
1094527697 12:31243358-31243380 GAGGGGCCTGGCAGAAGCAGAGG + Intergenic
1096489569 12:52006475-52006497 GCGGGGCTGCGCAGGAGTAGGGG - Intergenic
1096581811 12:52590544-52590566 GAAGGAGCCCGCAGGAGCAATGG - Intronic
1096843204 12:54391321-54391343 GAGGAGCCGGGGAGGAGCAGAGG + Intergenic
1097166764 12:57090112-57090134 GAGGGGCCACTGAGGAGCACTGG + Intronic
1097282649 12:57854217-57854239 GAGGGGGCGGGGAGGAGCAGAGG + Intergenic
1098392691 12:69985984-69986006 GTGGGGCCCCACATAAGCAGAGG + Intergenic
1100390400 12:94141798-94141820 GAGGGGCCTTACAGCAGCAGAGG + Intergenic
1100713645 12:97283513-97283535 GAGGGACCCTGCAGGAGGAGGGG + Intergenic
1100980087 12:100156870-100156892 CAGTGGGCACGCAGGAGCAGGGG - Intergenic
1101489954 12:105201194-105201216 GAGGGGCTGACCAGGAGCAGTGG - Intronic
1102149379 12:110678217-110678239 GAGGGGTCCCGCAGGAGGAGGGG - Intronic
1102220603 12:111191830-111191852 GAGGTGCCCCGAAGGAGGTGGGG - Intronic
1102532746 12:113558761-113558783 GAGGAGTCCAGCAGGAGCTGGGG + Intergenic
1102532985 12:113560334-113560356 GAGGAGCCCAGCAGGAGCTGGGG - Intergenic
1103856080 12:123972443-123972465 GAGGGGCCGGGCAGGGGCGGAGG - Intronic
1104049488 12:125186268-125186290 GAGGGGCCGCCCGGGAGCCGGGG - Intergenic
1105389265 13:19959362-19959384 GAGGGGACCCGGCGGAGCAGAGG - Intronic
1105512445 13:21061648-21061670 GAGCGGCCGCGGAGGAGCAGGGG - Intergenic
1105851548 13:24340280-24340302 GAGGCGCCCCCCGGTAGCAGCGG + Intergenic
1106113562 13:26797823-26797845 GAGGGCCCCATCAGGAGCTGGGG + Intergenic
1113123878 13:106954968-106954990 GAGGTGGCCAGCAGAAGCAGAGG + Intergenic
1113255419 13:108499973-108499995 CAGAGGGCCCGCCGGAGCAGAGG - Intergenic
1113561446 13:111284848-111284870 GAGGGCACCTGCAGGCGCAGAGG - Intronic
1113903007 13:113806830-113806852 GAGGAGGCCCGCAGGGGCAGAGG + Intronic
1113956308 13:114101446-114101468 GCGGGGCCCAGCACGGGCAGTGG - Intronic
1115386606 14:32805212-32805234 GAGGGACCAGGCAGGAGCCGTGG - Intronic
1115429511 14:33300584-33300606 GAGGGGACCCACAGGAGGAGTGG + Intronic
1118323931 14:64768976-64768998 GAGTACCCCCGCAGGAGTAGGGG - Intronic
1118447339 14:65863644-65863666 GTGGGTCCCATCAGGAGCAGAGG - Intergenic
1120190577 14:81436252-81436274 GAGGGGCCCCGCAGGTGGAGCGG - Intronic
1120865247 14:89290893-89290915 GAGGGGCCCTGGAGGAGGTGAGG + Intronic
1120881206 14:89416739-89416761 GAGGGACCCCGCAGGTCCTGGGG - Intronic
1121432565 14:93898337-93898359 CAGGGGCCACACAGGAGCTGGGG - Intergenic
1121440028 14:93942690-93942712 GAGGGGCCCAGCATGGGCAGTGG + Intronic
1122391646 14:101392474-101392496 GAGGGGCCTTGCTGTAGCAGTGG - Intergenic
1122766823 14:104078133-104078155 GAGGGACACTGCAGGAGGAGCGG + Intergenic
1122900938 14:104782098-104782120 CAGGGCCCCTGCAGGTGCAGCGG + Intronic
1122922709 14:104886562-104886584 GAGGGGCCCACGTGGAGCAGGGG + Exonic
1123006486 14:105326282-105326304 CGGGGGCTCCGCAGCAGCAGTGG + Intronic
1123108163 14:105852570-105852592 GCGGGGCCCCAGCGGAGCAGCGG + Intergenic
1124662477 15:31561513-31561535 GATGGGCCCGGGAGGAGCATGGG - Intronic
1125281011 15:38042801-38042823 GTGGGGCCTCGGAGGAGGAGTGG - Intergenic
1126351638 15:47750543-47750565 GAAGGGCCTGACAGGAGCAGTGG - Intronic
1131076579 15:89499166-89499188 TAGGTTCCCCACAGGAGCAGTGG + Intergenic
1131109913 15:89758646-89758668 GGGCAGCCCCACAGGAGCAGAGG + Intergenic
1131394532 15:92076219-92076241 TAGGGGCCCCGCTGGAGGTGAGG + Intronic
1131507197 15:93029378-93029400 GAGGGGCCCACCGGCAGCAGCGG - Intergenic
1131512917 15:93059328-93059350 GCGGAGCCCACCAGGAGCAGCGG + Intronic
1132402687 15:101523093-101523115 GAGGGGCCAGGCAGGACGAGGGG + Intronic
1132590211 16:723297-723319 GGGGGGCGCCACAGGAGCACGGG - Intronic
1132602568 16:780182-780204 GAGGGTCCCGGCGGGAGCAGGGG + Intronic
1132622318 16:873646-873668 GAGGGTCCCCGCGAGCGCAGGGG - Intronic
1132910548 16:2308552-2308574 GAGGGGCCACGAAGAAGTAGGGG + Exonic
1133205666 16:4232050-4232072 GTGGGGCCCAGCGGGAGCACCGG - Intronic
1133340171 16:5030794-5030816 GAGGGGACACCCAGGAGCTGAGG - Intronic
1133773040 16:8878672-8878694 GAAGGGCCCAGCTTGAGCAGAGG - Intergenic
1133805839 16:9125497-9125519 GAGGGGCTCTGGAGGAGGAGGGG + Intergenic
1134084295 16:11345889-11345911 GCGGGGACCCGCAGGGGCAGAGG - Intronic
1135513950 16:23113739-23113761 GAGGGGACCTTCAGGAGCAGAGG + Intronic
1135983288 16:27165385-27165407 GAGGGGCCTGGCACTAGCAGTGG - Intergenic
1136396128 16:29993514-29993536 GTCGGGCCCTGAAGGAGCAGAGG - Exonic
1137071514 16:35908418-35908440 CATGGGCCCCGCAGGACCACGGG - Intergenic
1137592835 16:49704176-49704198 GAGGGGGAACACAGGAGCAGGGG + Intronic
1137612321 16:49826948-49826970 GAGGGTCCCCGCTGCAACAGTGG + Exonic
1140208147 16:72950139-72950161 GAGGGAAACCACAGGAGCAGAGG + Intronic
1140760261 16:78103063-78103085 CAGGGGGCACGCAGGAGCAAGGG - Intronic
1141440608 16:84027439-84027461 GAGAGGGGCCTCAGGAGCAGAGG - Intronic
1141862823 16:86729555-86729577 GAGCGGCCCCAGTGGAGCAGAGG - Intergenic
1142666680 17:1467580-1467602 GGGGGGCCAGGCAGGAGGAGGGG + Intronic
1143135862 17:4711909-4711931 GAGGTGCCCAGTGGGAGCAGGGG - Intronic
1145826200 17:27878930-27878952 GCAGGGCGCTGCAGGAGCAGAGG + Exonic
1146003450 17:29145968-29145990 GAGGGGCCAGGCAGGCGTAGTGG + Intronic
1146721807 17:35129304-35129326 CTGGGCCCCAGCAGGAGCAGGGG + Intronic
1146932185 17:36785216-36785238 TAGGGGCCCTGTGGGAGCAGGGG - Intergenic
1147123977 17:38352816-38352838 GAGGGGCCCGGGAGGAGGCGGGG - Exonic
1147149687 17:38507461-38507483 CAGGGGGCCAGCAGGAGCAATGG - Intronic
1147258221 17:39194673-39194695 GAGGGGCCGGGCAGGGGCGGGGG + Intronic
1147259080 17:39197996-39198018 GGGGGGACCCGCAGGAAGAGAGG - Intergenic
1147374828 17:40017236-40017258 GTGGGGACCCTCAGGACCAGGGG - Exonic
1147384240 17:40072206-40072228 GAGGGGACCCTCAGGAGCCCTGG + Intronic
1147964643 17:44187490-44187512 GAGGGGCCCGGCAGGACCCCAGG - Intronic
1148698695 17:49575886-49575908 GAGCGGCGCCGCTGGAGCCGAGG + Exonic
1151444077 17:74151988-74152010 TAGGGTCCCCGCTGGAGCTGGGG + Intergenic
1151578356 17:74963913-74963935 GTGGGGGCAGGCAGGAGCAGAGG + Intronic
1151716614 17:75834418-75834440 TAGGGGCCGTGCTGGAGCAGGGG - Exonic
1151741264 17:75983817-75983839 GAGGGGGGCCGCAGGAGTGGTGG + Intronic
1151769868 17:76153512-76153534 GAGGGGCCTCAGAGCAGCAGGGG + Intronic
1152094604 17:78265905-78265927 CAGGGCCCTGGCAGGAGCAGAGG + Intergenic
1152269450 17:79315486-79315508 GATGGGACCCGCAGGGGTAGGGG + Intronic
1152270247 17:79320286-79320308 GAGGGACCTCCCAGGACCAGAGG + Intronic
1152430566 17:80246331-80246353 GGGGGGCCACACAGGAGTAGGGG + Intronic
1152616779 17:81341567-81341589 GAGGGGCCGCTCAGAAGCCGGGG + Intergenic
1152654409 17:81513167-81513189 GCGGGGCCGCGCCGGAGCTGGGG + Intronic
1152739388 17:82012367-82012389 GAGGGGCCTGGCAGGCGCTGGGG + Intronic
1152923981 17:83079405-83079427 GGGGGGCGCTGCAGGAGGAGGGG - Intergenic
1157766064 18:50298493-50298515 GAGGGGCACAGCAGGAGTTGCGG - Intergenic
1157766639 18:50302479-50302501 GAGGGGCACAGCAGGAGCTGCGG - Intergenic
1159040687 18:63320407-63320429 GCCGGGCCCCGCGGGCGCAGCGG - Intergenic
1159685809 18:71418490-71418512 GAGGGGTCCAGCAGGTGGAGAGG + Intergenic
1160179777 18:76624210-76624232 GATGGGCCCCACAGCAGCAGGGG + Intergenic
1160566502 18:79789579-79789601 GCGGGGCCCCCTGGGAGCAGCGG - Intergenic
1160760357 19:781086-781108 GTGGGGCCCCGGAGGGGCGGGGG + Intergenic
1161103970 19:2434232-2434254 GAGGGGCAGGGCAGGAGGAGAGG - Intronic
1161234280 19:3190210-3190232 GAGGGGCCTCCCAAGGGCAGAGG + Intronic
1161251188 19:3281184-3281206 GAGGCTCCCTGCAGGGGCAGCGG - Exonic
1161767776 19:6216558-6216580 GAGGGGCCCTGGAGGCTCAGTGG - Intronic
1161937449 19:7380902-7380924 GCCGGGCCCTGCAGGATCAGAGG - Exonic
1162135339 19:8551845-8551867 AAGGGGCCTCCCAGGAGCAAAGG - Exonic
1162325422 19:9996348-9996370 GAGGGGCTGGGCAGGAGAAGGGG - Intronic
1162792101 19:13068498-13068520 GAGGGGCCCCCAAGGAAGAGAGG + Intronic
1162959430 19:14117408-14117430 GAGGGGCCCCGTAGGGGGAGGGG + Intronic
1163442957 19:17330753-17330775 GGGGGGCACTGCAGGAGCAAAGG - Intronic
1163664472 19:18596822-18596844 GCGGGGCCTAGCAGGAGCGGGGG + Intronic
1163787021 19:19279972-19279994 GAGAGGCCACTCAGGTGCAGTGG + Intronic
1164387985 19:27793427-27793449 GAGTGGCCCCTCAGGAGGAAGGG + Intergenic
1164674235 19:30091134-30091156 GCGGGGACCGGCAGGAGCTGGGG + Intergenic
1165210444 19:34231537-34231559 GAGGGGCCCTGCAGAAGGAGCGG - Intergenic
1165793938 19:38507618-38507640 GACGGGGCCAGCAGGAGCAGAGG + Intronic
1166656835 19:44618421-44618443 GTGGGGCCCCGCAGTGGGAGGGG + Intronic
1167129110 19:47572915-47572937 GAGGGGCGCAGCAGGCGCGGCGG - Intergenic
1167649930 19:50723626-50723648 GAGGTGCCCAGGAGGAGGAGCGG + Exonic
926140948 2:10367783-10367805 GAGGGTGGCCGCAGCAGCAGAGG - Intronic
926202722 2:10813016-10813038 GAGAGGGCCCGGAGGAGCTGAGG - Intronic
926796811 2:16626257-16626279 CAGGGGGCCCGCTGGAGTAGGGG - Intronic
927847059 2:26477103-26477125 CTGGGGCCCCTCAGGATCAGGGG - Intronic
928186661 2:29116009-29116031 GAGAGTCCCCGCACGCGCAGTGG + Intronic
928189674 2:29151942-29151964 GAGGGGAGCGGCAGGGGCAGGGG - Intronic
932337375 2:70938799-70938821 GAGGTGCCCAGCAGGAGCAAAGG + Intronic
932761094 2:74439825-74439847 GCAGGGCCCCGGAGCAGCAGTGG - Intronic
934567876 2:95350585-95350607 CAGGGGGCCCGGAGCAGCAGGGG + Intronic
935217831 2:100988737-100988759 GTGGGGGCCTGGAGGAGCAGGGG - Intronic
935217862 2:100988829-100988851 GTGGGGGCCTGGAGGAGCAGGGG - Intronic
935217917 2:100988977-100988999 GTGGGGGCCTGGAGGAGCAGGGG - Intronic
935785014 2:106541011-106541033 CAGGAGCCCAGCAGGAGGAGAGG + Intergenic
935846034 2:107166562-107166584 CAGTGGCCCCGGAGGTGCAGAGG - Intergenic
936046388 2:109191345-109191367 GAGGGGCCTTGCAGTACCAGCGG + Intronic
936545989 2:113393814-113393836 GACGGGCCCCGCAGGGCCCGAGG + Intergenic
937996097 2:127696102-127696124 CAGCTGCCCCGCAGGTGCAGAGG + Intergenic
938108485 2:128549131-128549153 GAGGGCCCAGCCAGGAGCAGCGG - Intergenic
938288708 2:130138297-130138319 GTGGGGCCCCCAGGGAGCAGGGG + Intergenic
938370064 2:130763125-130763147 GAGGGTCCCTGCAGGGGCAGAGG - Exonic
938467825 2:131534635-131534657 GTGGGGCCCCCAGGGAGCAGGGG - Intergenic
940337747 2:152546588-152546610 CAGGGGCCCAGCAGAAGCAAAGG + Intronic
945045309 2:205776445-205776467 GAGGGGCCCCGTTGGTGTAGTGG - Intronic
946175226 2:217918453-217918475 GAGGTGCCCCGCCTGTGCAGGGG - Intronic
948265993 2:236635712-236635734 GTGGGGCCCAGCAGGTGCGGCGG - Intergenic
948336643 2:237213535-237213557 GAGTGACACCGGAGGAGCAGGGG + Intergenic
948368478 2:237473502-237473524 GAGGGGCCCAGCAGGAGCCTGGG + Intergenic
948425725 2:237885705-237885727 GAGGGGCACGGCAGGAGCGATGG - Intronic
948463999 2:238143544-238143566 GAGGGGCCCCGCAGCGGCTCTGG + Intronic
948722821 2:239912200-239912222 GGGGAGCCCAGCAGGACCAGAGG - Intronic
948725160 2:239929938-239929960 CAGGGGCAGCGGAGGAGCAGGGG - Intronic
948725185 2:239930040-239930062 CAGGGGCAGCGGAGGAGCAGGGG - Intronic
948725210 2:239930142-239930164 CAGGGGCAGCGGAGGAGCAGGGG - Intronic
949021646 2:241744157-241744179 GAGGGGCCCTGGAGGAACAGTGG - Intronic
1169207013 20:3746193-3746215 GAGTGGGCCTGCAGGAACAGGGG + Intronic
1170779266 20:19409241-19409263 AAGAGGCGCAGCAGGAGCAGAGG + Intronic
1172835338 20:37869693-37869715 GAGGGGACCCGGAGGAGGTGTGG + Intronic
1174718811 20:52789041-52789063 GAGAGGCACCGGAGGAGGAGCGG - Intergenic
1175206956 20:57318411-57318433 GAGGGGCCCTTTAAGAGCAGAGG - Intergenic
1175224912 20:57439299-57439321 GAGGGGCAGTGCAGGAGGAGGGG - Intergenic
1175462258 20:59160364-59160386 GAGGGGCCGTGCAGGAGCCCAGG + Intergenic
1175756513 20:61533583-61533605 GAGGGGCCCCTCATGGGCAGAGG - Intronic
1175887954 20:62302975-62302997 GCGGGGCCCGGCAGGCGCCGAGG + Exonic
1176024501 20:62978836-62978858 GAGGGGTCCCTGAGGAGGAGGGG - Intergenic
1179627013 21:42654347-42654369 GCGGGGCCCCGGAGGTGCAGCGG - Intronic
1179884397 21:44307246-44307268 TTGTGTCCCCGCAGGAGCAGCGG + Intronic
1179946975 21:44685189-44685211 GAGGACCCACACAGGAGCAGAGG + Intronic
1179959416 21:44759671-44759693 GAGGGGCCACGGGGCAGCAGGGG - Intergenic
1179994437 21:44967471-44967493 GTGGGACCCGGCAGGAGCTGTGG - Intronic
1180649916 22:17369399-17369421 GAGGGGCCGCCCACGAGGAGGGG - Exonic
1180708163 22:17822330-17822352 GCCGGGCCCCTCAGGAGCGGGGG - Intronic
1180798797 22:18621699-18621721 GAGGGGCCTCGCAGAAGCTGGGG - Intergenic
1181018578 22:20085996-20086018 GTGTGGGCCCGCAGGAGAAGCGG + Exonic
1181054796 22:20255748-20255770 CTGGGGCCCCTCAGGAGCCGGGG + Intronic
1181056611 22:20263254-20263276 GAAGTGCCCCGGAGGACCAGAGG - Intronic
1181222919 22:21373563-21373585 GAGGGGCCTCGCAGAAGCTGGGG + Intergenic
1181255822 22:21562057-21562079 GAGGGGCCTCGCAGAAGCTGGGG - Intronic
1181439620 22:22929019-22929041 CAGGGGCCCTGCTGGAGGAGAGG + Intergenic
1181477123 22:23175709-23175731 GAGGGGTTCAGCAGGAGGAGGGG - Intergenic
1182271109 22:29154119-29154141 CAGGGGACCACCAGGAGCAGGGG + Intronic
1182355317 22:29720189-29720211 CCGGGGCCCCGCAGGGGCAGCGG - Exonic
1182374704 22:29838120-29838142 AAGGGACCCCGGAGGAGCCGCGG - Intronic
1182586193 22:31345630-31345652 GAGGGGGCGGGCAGGTGCAGCGG - Exonic
1182903796 22:33920270-33920292 GGGGCGCCCCGCATGGGCAGGGG + Exonic
1183023378 22:35045239-35045261 GAGGGAGCCTGCAGGTGCAGAGG + Intergenic
1183321193 22:37166191-37166213 GAGGGTCCCCCCAGTAGCAGGGG - Intronic
1183361353 22:37384801-37384823 GAGGGGGCCAGCAGGGGCCGGGG - Intronic
1183622460 22:38982481-38982503 GAGGGGCCCAGCAGGCAGAGTGG - Intronic
1183724105 22:39578889-39578911 GTGGTGCCCAGCAGGAGCAAAGG - Intronic
1184272613 22:43393312-43393334 GAGGGGCCCAGCAGGGGAAAGGG - Intergenic
1184477471 22:44729411-44729433 GAGCGGCCCCGCAGTAGCCTTGG - Intronic
1184711289 22:46250772-46250794 GAGGGGCGCCGCAGGCGACGTGG - Intergenic
1185032086 22:48449532-48449554 GAGGAGCCATCCAGGAGCAGAGG + Intergenic
1185272580 22:49935807-49935829 GGGGGGTCCAGGAGGAGCAGGGG + Intergenic
949105635 3:197578-197600 GAGGAGCCACACAGGGGCAGTGG - Intronic
949562232 3:5213685-5213707 TAGGGAAACCGCAGGAGCAGCGG + Intronic
950305935 3:11915387-11915409 CTGGGGACCCGCAGGGGCAGTGG + Intergenic
950388386 3:12677601-12677623 GCTGGACCACGCAGGAGCAGAGG - Intergenic
950416897 3:12873949-12873971 CTGGGGACCCGCAGGGGCAGTGG + Intergenic
950556251 3:13697753-13697775 GTGGGGCACCGGAGGATCAGAGG + Intergenic
952295812 3:32061002-32061024 GAGGGACAGAGCAGGAGCAGGGG - Intronic
953197811 3:40750551-40750573 GAGGTGCCCTGGAGGAGCACTGG + Intergenic
953474471 3:43194057-43194079 CAAGGGCCCCACAGAAGCAGAGG - Intergenic
953620112 3:44525840-44525862 GAGGGGCCAGGCTGGAGCCGTGG - Intergenic
953793613 3:45966757-45966779 AAGGGGCACTGCAGGAGGAGAGG - Exonic
953947935 3:47164607-47164629 GAGGGGCCCGGGAGCAGCCGCGG - Intergenic
954083350 3:48225180-48225202 GTGGGCCCCCGCAGGAGCTTTGG - Intronic
954386964 3:50249213-50249235 GGGGGGAACTGCAGGAGCAGAGG - Intronic
954590363 3:51777473-51777495 GGTGGGCCCTGCAGGAGCGGTGG - Intergenic
954613817 3:51959552-51959574 GAGGGGAACAACAGGAGCAGTGG - Intronic
954630372 3:52044750-52044772 GAGGTGCCCCTCAGCAGCGGTGG + Intergenic
954638649 3:52085222-52085244 GAGGAGCCCAGCTGGGGCAGGGG - Intronic
954798157 3:53172011-53172033 GAGGGGCCCAGGAGGAGCGCTGG + Intronic
956106517 3:65824433-65824455 GAGGGGCCCAGCAGGTATAGAGG + Intronic
956420180 3:69079869-69079891 GAGGGCCCCTGCAGGAGCTGGGG + Intronic
958894849 3:99818058-99818080 GAGAGGCCCCGTAGGAGCGCGGG - Intronic
960710938 3:120527620-120527642 GAGGGGACCTGGAGGAGCATAGG - Intergenic
960937661 3:122913314-122913336 GCGGGGCACGGCAGGAGCAGCGG - Exonic
961044097 3:123696936-123696958 CGGGGGCCCCGCAGCAGCAGAGG - Intronic
961057997 3:123805046-123805068 CAGGGGTCCAGCAGGAGCTGTGG - Intronic
961074707 3:123971502-123971524 GAGAGGACCCCCAGGGGCAGAGG - Intronic
961360564 3:126364714-126364736 CAGGGTCCCCCCAGCAGCAGAGG - Intergenic
962354002 3:134678128-134678150 GAGGAGCACAGCATGAGCAGAGG - Intronic
962707630 3:138061010-138061032 GAGGTGCCCCACAGAAGCACAGG + Intergenic
964041693 3:152268863-152268885 GAGGGGCCGCGCAGCAGCAGCGG + Exonic
966933389 3:184690338-184690360 GGAGGGCCCCGCAGCAGCTGTGG + Intergenic
968514997 4:1012076-1012098 CCGGGGGCCCGCAGGAGCGGCGG - Intronic
968545418 4:1195396-1195418 GAGGGACCCCTGAGGCGCAGGGG - Intronic
968593513 4:1471311-1471333 GTGGGGTCCCTCATGAGCAGGGG + Intergenic
968612953 4:1565300-1565322 GAGAGACCCCTGAGGAGCAGGGG - Intergenic
968629174 4:1641384-1641406 GATGGCTCCCGCAGGAGCAGCGG - Exonic
968701214 4:2059112-2059134 GAGGGGCCCGGCACGGGCGGGGG - Intergenic
968741902 4:2335338-2335360 GAGTGGCCACGCAGGGGCTGTGG - Intronic
968939438 4:3630407-3630429 GAGGGGCGCCTCAGGGGGAGGGG + Intergenic
968965199 4:3766097-3766119 GCGGGGGCCCGGAGGAGCGGCGG + Intergenic
969670146 4:8585701-8585723 GAGGGGCACAGCCAGAGCAGAGG - Intronic
974063528 4:57056123-57056145 GAGGGGCCAAGCTGGAGAAGAGG - Intronic
976273517 4:83252972-83252994 GAGGGACCCTGCAGGAGGAAAGG - Intergenic
976281946 4:83334619-83334641 GAGGGGCTCACCAGGTGCAGCGG + Exonic
979829298 4:125280873-125280895 GAGGGGCCCCCCCAGTGCAGTGG - Intergenic
984938601 4:184911823-184911845 GAGGGTCCCCACAGGAGCTGGGG - Intergenic
985640226 5:1060162-1060184 CAGAGGCCCTGCAGGAGCACAGG - Intronic
985680100 5:1251701-1251723 GCGGGGACTCCCAGGAGCAGAGG - Intergenic
985690488 5:1308651-1308673 CAGAGGCCCTGTAGGAGCAGAGG - Intergenic
985696512 5:1344075-1344097 GGGAGGCTCCGAAGGAGCAGGGG - Intronic
985790216 5:1922713-1922735 GAGGGGTCCCTGAGCAGCAGCGG - Intergenic
985905453 5:2831551-2831573 GAGGAGGCCCGCGGGAGGAGAGG + Intergenic
986263986 5:6176792-6176814 GAGGGGTGGGGCAGGAGCAGGGG - Intergenic
988358347 5:30204553-30204575 AAGGGGCCCTGCAGTGGCAGTGG - Intergenic
990992335 5:61698369-61698391 GAATTGCCCCTCAGGAGCAGAGG - Intronic
992042414 5:72848652-72848674 GAGTCGCCCGGCAGGGGCAGCGG - Intronic
993703435 5:91144059-91144081 GAGCGGGCCTGCAGGGGCAGTGG + Intronic
994124723 5:96155960-96155982 GAGGGGCCCTGCAATAGCAGAGG + Intergenic
995145978 5:108787318-108787340 GAGGGGGGCCGCAGGGGCTGAGG + Intronic
996379040 5:122845517-122845539 TCGGGGCCCCGCGGGCGCAGCGG + Exonic
996515573 5:124365738-124365760 GAGGGGACACTCAGAAGCAGGGG + Intergenic
996862617 5:128083574-128083596 GTGGGGTCGCGCAGGAGCCGCGG + Intergenic
997736791 5:136218736-136218758 GAGGAGCCCCTCAGGAGGAAGGG + Intronic
1000368263 5:160510879-160510901 GAGAGGCCACGCAGCATCAGTGG - Intergenic
1001005000 5:168042315-168042337 GAGCAGGCCCCCAGGAGCAGGGG - Intronic
1001065566 5:168532655-168532677 GAGGGGCTCTGCAGCAGCTGAGG + Intergenic
1001227210 5:169955208-169955230 GAGTGGTCCTGCAGGAGAAGGGG + Intronic
1002180963 5:177431002-177431024 GAGGGGCCCTGCTGGGGCCGGGG + Intronic
1003097804 6:3156381-3156403 GAGGGGCCCTGGAGGAGGAGGGG + Intronic
1003101534 6:3179939-3179961 GAGGGGCCCTGGAGGAGGAGGGG + Intergenic
1003901534 6:10659810-10659832 GAGGGGCCCCGACAGCGCAGAGG - Intergenic
1004864389 6:19838319-19838341 GGGGGAGCCCGGAGGAGCAGGGG - Intronic
1005927065 6:30452905-30452927 CTGGGGCCTCGCAGGAGGAGCGG - Intergenic
1006121174 6:31806856-31806878 GCGGGACCGCGCAGGCGCAGCGG + Exonic
1006193284 6:32222464-32222486 GAGGGGACAGGCAGGAGCAATGG - Intronic
1006861619 6:37175161-37175183 GAGGGGCCCCACAGAAGCCAGGG - Exonic
1011627684 6:89296667-89296689 GAAGGGCCCAGCAGATGCAGTGG + Intronic
1012922613 6:105235043-105235065 GAGGGGGGCCAGAGGAGCAGGGG + Intergenic
1013391462 6:109690378-109690400 GGGGGTCCCCGCAGGAGGCGGGG + Intronic
1018180377 6:161217845-161217867 GCAGGGCCCCGCGGGAGCAGAGG - Intronic
1018424863 6:163671274-163671296 TGGAGGCCACGCAGGAGCAGCGG - Intergenic
1018494881 6:164338635-164338657 CAGGGGACCCGAAGGAGCAGAGG - Intergenic
1019211162 6:170406261-170406283 GCATGGCCCAGCAGGAGCAGGGG - Exonic
1019292978 7:259257-259279 GAGGGGCCCGGCAGGAGGATGGG - Intronic
1019438764 7:1036235-1036257 GAGGGGCCCCCCATAAGCTGCGG + Intronic
1021841199 7:24723180-24723202 GAGAGGCCCCACAGGGACAGCGG + Intronic
1023821246 7:43981790-43981812 GAGGGGCCCCGCAGGAGCAGGGG - Intergenic
1023862700 7:44225640-44225662 GAGTGAACCCACAGGAGCAGCGG - Intronic
1027774013 7:82443309-82443331 GAGGGGCGCCGCGGGAGTTGGGG - Intronic
1029672778 7:102045427-102045449 GAGGGGGCGCGCGGGCGCAGTGG - Intronic
1029749515 7:102535214-102535236 GAGGGGCCCCGCAGGAGCAGGGG - Intergenic
1029767463 7:102634317-102634339 GAGGGGCCCCGCAGGAGCAGGGG - Intronic
1030237835 7:107286077-107286099 GAGGGGCCCTGAAGGAAAAGAGG + Intronic
1031156929 7:118121166-118121188 GAGGGACCCCCCAGGAGTGGGGG - Intergenic
1032240334 7:130154558-130154580 GGGAGGCCCCGCAGGAGCCCTGG + Intergenic
1032268928 7:130386551-130386573 GAGGGGCACTGGAGGAGAAGTGG - Intronic
1034440514 7:151083444-151083466 GAGGGGCCGCGATGGAGCTGGGG - Intronic
1034659900 7:152759948-152759970 GCGGGGCCGCGGAGGAGCGGGGG - Intronic
1034695182 7:153047190-153047212 CAGGGGCCCTGTAGGAGCATCGG - Intergenic
1034711251 7:153193266-153193288 GAGGAGCCCCGCGGGCGAAGAGG + Intergenic
1036797391 8:11766201-11766223 TACGGGCACCTCAGGAGCAGGGG - Intergenic
1037957006 8:23068147-23068169 GAGCGGCCCCGCACGCGTAGGGG + Intronic
1037962120 8:23105467-23105489 GAGGGGCCATGGAGGAACAGAGG + Intronic
1037965400 8:23129982-23130004 GAGGGGCCATGGAGGAACAGAGG + Intergenic
1037977022 8:23221025-23221047 GAGGGGCCGTGGAGGAACAGAGG - Intronic
1038493453 8:27985849-27985871 GAGGGGCCCAGAAGGCGCAGTGG + Intronic
1038671196 8:29584560-29584582 GAAGGGCCAAGCAAGAGCAGTGG + Intergenic
1041078629 8:54191994-54192016 GAGGGGCCCTGTAGGAGGTGTGG + Intergenic
1041094199 8:54333019-54333041 GAGTGGCCCCTGAGGAGCAGGGG - Intergenic
1041868341 8:62603409-62603431 GAAGTGCCCTGCAGGAGCAGAGG + Intronic
1042710656 8:71713358-71713380 GATGGGCTGGGCAGGAGCAGAGG - Intergenic
1042762481 8:72285963-72285985 GAGGGTCCCAGTAGGGGCAGCGG + Intergenic
1045573391 8:103393165-103393187 GAGGGGCACTGCAGGAGGAAAGG + Intergenic
1045688434 8:104735679-104735701 GAGGGGACCGGCAGGAGAATAGG + Intronic
1047301353 8:123616161-123616183 CAGGGGCCCCACAGGATAAGGGG + Intergenic
1048821206 8:138382336-138382358 GAGGAGCCCCTCAGGAGGATTGG - Intronic
1049331472 8:142056354-142056376 AAGGGGCCCGGCATGAGCAGAGG + Intergenic
1049443902 8:142621459-142621481 GGGGGGCCAAGGAGGAGCAGGGG + Intergenic
1049796068 8:144497766-144497788 GCGGGGCCCCACGGGAGCAGGGG + Intronic
1050372436 9:4935329-4935351 GAGAGGCCCAGTAGGAGCATGGG - Intergenic
1052823821 9:33161060-33161082 GAGGGGCTCTGGAGAAGCAGCGG + Intronic
1056224651 9:84483166-84483188 GAAGGGCCCCCGTGGAGCAGAGG + Intergenic
1056900225 9:90592301-90592323 CAGGGTCCCCGCATGAGCACTGG - Intergenic
1057356046 9:94332391-94332413 GGAGGGCCCCGCAGGAGATGGGG - Intergenic
1057524209 9:95784642-95784664 GAAGGACCCCGCTGGAGGAGGGG - Intergenic
1057651706 9:96925237-96925259 GGAGGGCCCCGCAGGAGATGGGG + Intronic
1057892780 9:98881737-98881759 GAGGCAGCCAGCAGGAGCAGTGG - Intergenic
1058941737 9:109819569-109819591 GAGTGGCCCCCCAGAAGCACAGG + Intronic
1060348212 9:122835385-122835407 GAGGGGCATTGCAGGAGGAGGGG + Intergenic
1060430104 9:123543678-123543700 TAGGAGCTCCCCAGGAGCAGGGG - Intronic
1060959317 9:127668203-127668225 GAGGCGCCTCGCTGGAGAAGGGG - Intronic
1060976097 9:127766124-127766146 CAGGGGCCCTGTAGGAGAAGGGG + Intronic
1061067344 9:128286732-128286754 GATGGGCCCCAGAGGAGGAGAGG + Intronic
1061085041 9:128393567-128393589 GAGGGGTCCGGCCGGTGCAGAGG - Intergenic
1061878045 9:133554663-133554685 GAGGGGCCCCCCAGGGGCAAGGG + Exonic
1062238134 9:135522347-135522369 GAGGGGCCCTGAGGGGGCAGAGG + Intronic
1062312758 9:135948135-135948157 GAGGGGCAGAGCAGGAGCAAGGG + Intronic
1062332535 9:136051007-136051029 GAGGGGCCGCGCTGGAGCAGCGG + Intronic
1062366181 9:136210244-136210266 GAGGGGCCTCCCAGGAGCTTGGG + Intronic
1062393955 9:136345150-136345172 GAGGGGTCCGGCAGGCACAGGGG + Intronic
1203360439 Un_KI270442v1:216691-216713 GAGGGGCGCTGCAGTAGCGGTGG + Intergenic
1190982697 X:55470574-55470596 GTGGGGCCTGACAGGAGCAGTGG + Intergenic
1190986002 X:55502609-55502631 GTGGGGCCTGACAGGAGCAGTGG - Intergenic
1192196878 X:69034445-69034467 CAGAGGCCCCACAAGAGCAGGGG + Intergenic
1195709294 X:107761223-107761245 GAGAGGCCACCAAGGAGCAGAGG - Intronic
1200071654 X:153532240-153532262 GAGGGGCCCCATGGGAGCGGGGG + Intronic