ID: 1023824174

View in Genome Browser
Species Human (GRCh38)
Location 7:43997691-43997713
Sequence GCATGGGCAGGCAGGTGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023824174_1023824189 9 Left 1023824174 7:43997691-43997713 CCCCAGCACCTGCCTGCCCATGC No data
Right 1023824189 7:43997723-43997745 GTGACTCATAAGACAGGGTGGGG No data
1023824174_1023824186 4 Left 1023824174 7:43997691-43997713 CCCCAGCACCTGCCTGCCCATGC No data
Right 1023824186 7:43997718-43997740 TTGGGGTGACTCATAAGACAGGG No data
1023824174_1023824185 3 Left 1023824174 7:43997691-43997713 CCCCAGCACCTGCCTGCCCATGC No data
Right 1023824185 7:43997717-43997739 TTTGGGGTGACTCATAAGACAGG No data
1023824174_1023824187 7 Left 1023824174 7:43997691-43997713 CCCCAGCACCTGCCTGCCCATGC No data
Right 1023824187 7:43997721-43997743 GGGTGACTCATAAGACAGGGTGG No data
1023824174_1023824188 8 Left 1023824174 7:43997691-43997713 CCCCAGCACCTGCCTGCCCATGC No data
Right 1023824188 7:43997722-43997744 GGTGACTCATAAGACAGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023824174 Original CRISPR GCATGGGCAGGCAGGTGCTG GGG (reversed) Intergenic
No off target data available for this crispr