ID: 1023824845

View in Genome Browser
Species Human (GRCh38)
Location 7:44002133-44002155
Sequence TTGTGCTTCTAGAAGAGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85959
Summary {0: 8, 1: 0, 2: 152, 3: 5593, 4: 80206}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023824845_1023824855 28 Left 1023824845 7:44002133-44002155 CCCTGTCTCTTCTAGAAGCACAA 0: 8
1: 0
2: 152
3: 5593
4: 80206
Right 1023824855 7:44002184-44002206 TGTAATCCCAGCTACTTGGGAGG 0: 48952
1: 142577
2: 242332
3: 522592
4: 386712
1023824845_1023824851 1 Left 1023824845 7:44002133-44002155 CCCTGTCTCTTCTAGAAGCACAA 0: 8
1: 0
2: 152
3: 5593
4: 80206
Right 1023824851 7:44002157-44002179 AATGAGCTGGGCGTTCTGGTGGG No data
1023824845_1023824853 25 Left 1023824845 7:44002133-44002155 CCCTGTCTCTTCTAGAAGCACAA 0: 8
1: 0
2: 152
3: 5593
4: 80206
Right 1023824853 7:44002181-44002203 ACCTGTAATCCCAGCTACTTGGG 0: 15366
1: 98640
2: 233329
3: 337639
4: 469862
1023824845_1023824852 24 Left 1023824845 7:44002133-44002155 CCCTGTCTCTTCTAGAAGCACAA 0: 8
1: 0
2: 152
3: 5593
4: 80206
Right 1023824852 7:44002180-44002202 CACCTGTAATCCCAGCTACTTGG 0: 27298
1: 77225
2: 165100
3: 221696
4: 302720
1023824845_1023824849 -3 Left 1023824845 7:44002133-44002155 CCCTGTCTCTTCTAGAAGCACAA 0: 8
1: 0
2: 152
3: 5593
4: 80206
Right 1023824849 7:44002153-44002175 CAAAAATGAGCTGGGCGTTCTGG No data
1023824845_1023824850 0 Left 1023824845 7:44002133-44002155 CCCTGTCTCTTCTAGAAGCACAA 0: 8
1: 0
2: 152
3: 5593
4: 80206
Right 1023824850 7:44002156-44002178 AAATGAGCTGGGCGTTCTGGTGG 0: 7
1: 4
2: 346
3: 13246
4: 49677

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023824845 Original CRISPR TTGTGCTTCTAGAAGAGACA GGG (reversed) Intronic
Too many off-targets to display for this crispr