ID: 1023824846

View in Genome Browser
Species Human (GRCh38)
Location 7:44002134-44002156
Sequence TTTGTGCTTCTAGAAGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205095
Summary {0: 8, 1: 0, 2: 308, 3: 12950, 4: 191829}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023824846_1023824855 27 Left 1023824846 7:44002134-44002156 CCTGTCTCTTCTAGAAGCACAAA 0: 8
1: 0
2: 308
3: 12950
4: 191829
Right 1023824855 7:44002184-44002206 TGTAATCCCAGCTACTTGGGAGG 0: 48952
1: 142577
2: 242332
3: 522592
4: 386712
1023824846_1023824851 0 Left 1023824846 7:44002134-44002156 CCTGTCTCTTCTAGAAGCACAAA 0: 8
1: 0
2: 308
3: 12950
4: 191829
Right 1023824851 7:44002157-44002179 AATGAGCTGGGCGTTCTGGTGGG No data
1023824846_1023824853 24 Left 1023824846 7:44002134-44002156 CCTGTCTCTTCTAGAAGCACAAA 0: 8
1: 0
2: 308
3: 12950
4: 191829
Right 1023824853 7:44002181-44002203 ACCTGTAATCCCAGCTACTTGGG 0: 15366
1: 98640
2: 233329
3: 337639
4: 469862
1023824846_1023824850 -1 Left 1023824846 7:44002134-44002156 CCTGTCTCTTCTAGAAGCACAAA 0: 8
1: 0
2: 308
3: 12950
4: 191829
Right 1023824850 7:44002156-44002178 AAATGAGCTGGGCGTTCTGGTGG 0: 7
1: 4
2: 346
3: 13246
4: 49677
1023824846_1023824849 -4 Left 1023824846 7:44002134-44002156 CCTGTCTCTTCTAGAAGCACAAA 0: 8
1: 0
2: 308
3: 12950
4: 191829
Right 1023824849 7:44002153-44002175 CAAAAATGAGCTGGGCGTTCTGG No data
1023824846_1023824852 23 Left 1023824846 7:44002134-44002156 CCTGTCTCTTCTAGAAGCACAAA 0: 8
1: 0
2: 308
3: 12950
4: 191829
Right 1023824852 7:44002180-44002202 CACCTGTAATCCCAGCTACTTGG 0: 27298
1: 77225
2: 165100
3: 221696
4: 302720

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023824846 Original CRISPR TTTGTGCTTCTAGAAGAGAC AGG (reversed) Intronic
Too many off-targets to display for this crispr