ID: 1023824850

View in Genome Browser
Species Human (GRCh38)
Location 7:44002156-44002178
Sequence AAATGAGCTGGGCGTTCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63280
Summary {0: 7, 1: 4, 2: 346, 3: 13246, 4: 49677}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023824842_1023824850 23 Left 1023824842 7:44002110-44002132 CCAGCCTGGCCAACATGGTGAAA 0: 87987
1: 159650
2: 173325
3: 160643
4: 141633
Right 1023824850 7:44002156-44002178 AAATGAGCTGGGCGTTCTGGTGG 0: 7
1: 4
2: 346
3: 13246
4: 49677
1023824843_1023824850 19 Left 1023824843 7:44002114-44002136 CCTGGCCAACATGGTGAAACCCT 0: 29630
1: 119747
2: 180457
3: 189702
4: 141729
Right 1023824850 7:44002156-44002178 AAATGAGCTGGGCGTTCTGGTGG 0: 7
1: 4
2: 346
3: 13246
4: 49677
1023824846_1023824850 -1 Left 1023824846 7:44002134-44002156 CCTGTCTCTTCTAGAAGCACAAA 0: 8
1: 0
2: 308
3: 12950
4: 191829
Right 1023824850 7:44002156-44002178 AAATGAGCTGGGCGTTCTGGTGG 0: 7
1: 4
2: 346
3: 13246
4: 49677
1023824845_1023824850 0 Left 1023824845 7:44002133-44002155 CCCTGTCTCTTCTAGAAGCACAA 0: 8
1: 0
2: 152
3: 5593
4: 80206
Right 1023824850 7:44002156-44002178 AAATGAGCTGGGCGTTCTGGTGG 0: 7
1: 4
2: 346
3: 13246
4: 49677
1023824844_1023824850 14 Left 1023824844 7:44002119-44002141 CCAACATGGTGAAACCCTGTCTC 0: 31762
1: 84237
2: 130975
3: 115475
4: 69762
Right 1023824850 7:44002156-44002178 AAATGAGCTGGGCGTTCTGGTGG 0: 7
1: 4
2: 346
3: 13246
4: 49677

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023824850 Original CRISPR AAATGAGCTGGGCGTTCTGG TGG Intronic
Too many off-targets to display for this crispr