ID: 1023824853

View in Genome Browser
Species Human (GRCh38)
Location 7:44002181-44002203
Sequence ACCTGTAATCCCAGCTACTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1154836
Summary {0: 15366, 1: 98640, 2: 233329, 3: 337639, 4: 469862}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023824845_1023824853 25 Left 1023824845 7:44002133-44002155 CCCTGTCTCTTCTAGAAGCACAA 0: 8
1: 0
2: 152
3: 5593
4: 80206
Right 1023824853 7:44002181-44002203 ACCTGTAATCCCAGCTACTTGGG 0: 15366
1: 98640
2: 233329
3: 337639
4: 469862
1023824846_1023824853 24 Left 1023824846 7:44002134-44002156 CCTGTCTCTTCTAGAAGCACAAA 0: 8
1: 0
2: 308
3: 12950
4: 191829
Right 1023824853 7:44002181-44002203 ACCTGTAATCCCAGCTACTTGGG 0: 15366
1: 98640
2: 233329
3: 337639
4: 469862

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023824853 Original CRISPR ACCTGTAATCCCAGCTACTT GGG Intronic
Too many off-targets to display for this crispr