ID: 1023824853 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:44002181-44002203 |
Sequence | ACCTGTAATCCCAGCTACTT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 1154836 | |||
Summary | {0: 15366, 1: 98640, 2: 233329, 3: 337639, 4: 469862} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1023824845_1023824853 | 25 | Left | 1023824845 | 7:44002133-44002155 | CCCTGTCTCTTCTAGAAGCACAA | 0: 8 1: 0 2: 152 3: 5593 4: 80206 |
||
Right | 1023824853 | 7:44002181-44002203 | ACCTGTAATCCCAGCTACTTGGG | 0: 15366 1: 98640 2: 233329 3: 337639 4: 469862 |
||||
1023824846_1023824853 | 24 | Left | 1023824846 | 7:44002134-44002156 | CCTGTCTCTTCTAGAAGCACAAA | 0: 8 1: 0 2: 308 3: 12950 4: 191829 |
||
Right | 1023824853 | 7:44002181-44002203 | ACCTGTAATCCCAGCTACTTGGG | 0: 15366 1: 98640 2: 233329 3: 337639 4: 469862 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1023824853 | Original CRISPR | ACCTGTAATCCCAGCTACTT GGG | Intronic | ||
Too many off-targets to display for this crispr |