ID: 1023826987

View in Genome Browser
Species Human (GRCh38)
Location 7:44016294-44016316
Sequence CTCTGGGCATTTTATAACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023826987_1023826997 28 Left 1023826987 7:44016294-44016316 CCAAGGTTATAAAATGCCCAGAG No data
Right 1023826997 7:44016345-44016367 CAGAGAGACTGAGGAAGACTTGG No data
1023826987_1023826996 19 Left 1023826987 7:44016294-44016316 CCAAGGTTATAAAATGCCCAGAG No data
Right 1023826996 7:44016336-44016358 CCTGTAGCTCAGAGAGACTGAGG No data
1023826987_1023826988 -8 Left 1023826987 7:44016294-44016316 CCAAGGTTATAAAATGCCCAGAG No data
Right 1023826988 7:44016309-44016331 GCCCAGAGCAAGCCCCCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023826987 Original CRISPR CTCTGGGCATTTTATAACCT TGG (reversed) Intergenic
No off target data available for this crispr