ID: 1023826988

View in Genome Browser
Species Human (GRCh38)
Location 7:44016309-44016331
Sequence GCCCAGAGCAAGCCCCCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023826987_1023826988 -8 Left 1023826987 7:44016294-44016316 CCAAGGTTATAAAATGCCCAGAG No data
Right 1023826988 7:44016309-44016331 GCCCAGAGCAAGCCCCCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023826988 Original CRISPR GCCCAGAGCAAGCCCCCAGA AGG Intergenic
No off target data available for this crispr