ID: 1023830933

View in Genome Browser
Species Human (GRCh38)
Location 7:44038755-44038777
Sequence GCTCTGAGAGGCCGGCAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023830933_1023830942 11 Left 1023830933 7:44038755-44038777 CCCACTTGCCGGCCTCTCAGAGC No data
Right 1023830942 7:44038789-44038811 GCCTCCCTCCTTACCCACCTTGG No data
1023830933_1023830947 18 Left 1023830933 7:44038755-44038777 CCCACTTGCCGGCCTCTCAGAGC No data
Right 1023830947 7:44038796-44038818 TCCTTACCCACCTTGGAGCTGGG No data
1023830933_1023830946 17 Left 1023830933 7:44038755-44038777 CCCACTTGCCGGCCTCTCAGAGC No data
Right 1023830946 7:44038795-44038817 CTCCTTACCCACCTTGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023830933 Original CRISPR GCTCTGAGAGGCCGGCAAGT GGG (reversed) Intergenic
No off target data available for this crispr