ID: 1023830941

View in Genome Browser
Species Human (GRCh38)
Location 7:44038786-44038808
Sequence AGGTGGGTAAGGAGGGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023830941_1023830955 21 Left 1023830941 7:44038786-44038808 CCGGCCTCCCTCCTTACCCACCT No data
Right 1023830955 7:44038830-44038852 AGCTGAGGGCCTCGGTAGTGAGG No data
1023830941_1023830953 7 Left 1023830941 7:44038786-44038808 CCGGCCTCCCTCCTTACCCACCT No data
Right 1023830953 7:44038816-44038838 GGGCGTCTTCGCGAAGCTGAGGG No data
1023830941_1023830956 22 Left 1023830941 7:44038786-44038808 CCGGCCTCCCTCCTTACCCACCT No data
Right 1023830956 7:44038831-44038853 GCTGAGGGCCTCGGTAGTGAGGG No data
1023830941_1023830952 6 Left 1023830941 7:44038786-44038808 CCGGCCTCCCTCCTTACCCACCT No data
Right 1023830952 7:44038815-44038837 TGGGCGTCTTCGCGAAGCTGAGG No data
1023830941_1023830954 13 Left 1023830941 7:44038786-44038808 CCGGCCTCCCTCCTTACCCACCT No data
Right 1023830954 7:44038822-44038844 CTTCGCGAAGCTGAGGGCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023830941 Original CRISPR AGGTGGGTAAGGAGGGAGGC CGG (reversed) Intergenic
No off target data available for this crispr