ID: 1023830953

View in Genome Browser
Species Human (GRCh38)
Location 7:44038816-44038838
Sequence GGGCGTCTTCGCGAAGCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023830940_1023830953 14 Left 1023830940 7:44038779-44038801 CCACTTGCCGGCCTCCCTCCTTA No data
Right 1023830953 7:44038816-44038838 GGGCGTCTTCGCGAAGCTGAGGG No data
1023830949_1023830953 -9 Left 1023830949 7:44038802-44038824 CCCACCTTGGAGCTGGGCGTCTT No data
Right 1023830953 7:44038816-44038838 GGGCGTCTTCGCGAAGCTGAGGG No data
1023830944_1023830953 0 Left 1023830944 7:44038793-44038815 CCCTCCTTACCCACCTTGGAGCT No data
Right 1023830953 7:44038816-44038838 GGGCGTCTTCGCGAAGCTGAGGG No data
1023830941_1023830953 7 Left 1023830941 7:44038786-44038808 CCGGCCTCCCTCCTTACCCACCT No data
Right 1023830953 7:44038816-44038838 GGGCGTCTTCGCGAAGCTGAGGG No data
1023830935_1023830953 30 Left 1023830935 7:44038763-44038785 CCGGCCTCTCAGAGCCCCACTTG No data
Right 1023830953 7:44038816-44038838 GGGCGTCTTCGCGAAGCTGAGGG No data
1023830936_1023830953 26 Left 1023830936 7:44038767-44038789 CCTCTCAGAGCCCCACTTGCCGG No data
Right 1023830953 7:44038816-44038838 GGGCGTCTTCGCGAAGCTGAGGG No data
1023830943_1023830953 3 Left 1023830943 7:44038790-44038812 CCTCCCTCCTTACCCACCTTGGA No data
Right 1023830953 7:44038816-44038838 GGGCGTCTTCGCGAAGCTGAGGG No data
1023830938_1023830953 16 Left 1023830938 7:44038777-44038799 CCCCACTTGCCGGCCTCCCTCCT No data
Right 1023830953 7:44038816-44038838 GGGCGTCTTCGCGAAGCTGAGGG No data
1023830948_1023830953 -4 Left 1023830948 7:44038797-44038819 CCTTACCCACCTTGGAGCTGGGC No data
Right 1023830953 7:44038816-44038838 GGGCGTCTTCGCGAAGCTGAGGG No data
1023830945_1023830953 -1 Left 1023830945 7:44038794-44038816 CCTCCTTACCCACCTTGGAGCTG No data
Right 1023830953 7:44038816-44038838 GGGCGTCTTCGCGAAGCTGAGGG No data
1023830939_1023830953 15 Left 1023830939 7:44038778-44038800 CCCACTTGCCGGCCTCCCTCCTT No data
Right 1023830953 7:44038816-44038838 GGGCGTCTTCGCGAAGCTGAGGG No data
1023830950_1023830953 -10 Left 1023830950 7:44038803-44038825 CCACCTTGGAGCTGGGCGTCTTC No data
Right 1023830953 7:44038816-44038838 GGGCGTCTTCGCGAAGCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023830953 Original CRISPR GGGCGTCTTCGCGAAGCTGA GGG Intergenic
No off target data available for this crispr