ID: 1023831286

View in Genome Browser
Species Human (GRCh38)
Location 7:44040225-44040247
Sequence GCTCCTGTTGGCCAAGGTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023831286_1023831295 -4 Left 1023831286 7:44040225-44040247 CCCGCACCTTGGCCAACAGGAGC No data
Right 1023831295 7:44040244-44040266 GAGCAGGGTGCGGCTGGTGCGGG No data
1023831286_1023831293 -10 Left 1023831286 7:44040225-44040247 CCCGCACCTTGGCCAACAGGAGC No data
Right 1023831293 7:44040238-44040260 CAACAGGAGCAGGGTGCGGCTGG No data
1023831286_1023831294 -5 Left 1023831286 7:44040225-44040247 CCCGCACCTTGGCCAACAGGAGC No data
Right 1023831294 7:44040243-44040265 GGAGCAGGGTGCGGCTGGTGCGG No data
1023831286_1023831296 7 Left 1023831286 7:44040225-44040247 CCCGCACCTTGGCCAACAGGAGC No data
Right 1023831296 7:44040255-44040277 GGCTGGTGCGGGCGTCCGCGTGG No data
1023831286_1023831299 22 Left 1023831286 7:44040225-44040247 CCCGCACCTTGGCCAACAGGAGC No data
Right 1023831299 7:44040270-44040292 CCGCGTGGCGCTCCCGCAGGTGG No data
1023831286_1023831297 19 Left 1023831286 7:44040225-44040247 CCCGCACCTTGGCCAACAGGAGC No data
Right 1023831297 7:44040267-44040289 CGTCCGCGTGGCGCTCCCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023831286 Original CRISPR GCTCCTGTTGGCCAAGGTGC GGG (reversed) Intergenic
No off target data available for this crispr