ID: 1023831287

View in Genome Browser
Species Human (GRCh38)
Location 7:44040226-44040248
Sequence TGCTCCTGTTGGCCAAGGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023831287_1023831297 18 Left 1023831287 7:44040226-44040248 CCGCACCTTGGCCAACAGGAGCA No data
Right 1023831297 7:44040267-44040289 CGTCCGCGTGGCGCTCCCGCAGG No data
1023831287_1023831295 -5 Left 1023831287 7:44040226-44040248 CCGCACCTTGGCCAACAGGAGCA No data
Right 1023831295 7:44040244-44040266 GAGCAGGGTGCGGCTGGTGCGGG No data
1023831287_1023831296 6 Left 1023831287 7:44040226-44040248 CCGCACCTTGGCCAACAGGAGCA No data
Right 1023831296 7:44040255-44040277 GGCTGGTGCGGGCGTCCGCGTGG No data
1023831287_1023831294 -6 Left 1023831287 7:44040226-44040248 CCGCACCTTGGCCAACAGGAGCA No data
Right 1023831294 7:44040243-44040265 GGAGCAGGGTGCGGCTGGTGCGG No data
1023831287_1023831299 21 Left 1023831287 7:44040226-44040248 CCGCACCTTGGCCAACAGGAGCA No data
Right 1023831299 7:44040270-44040292 CCGCGTGGCGCTCCCGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023831287 Original CRISPR TGCTCCTGTTGGCCAAGGTG CGG (reversed) Intergenic
No off target data available for this crispr