ID: 1023831290

View in Genome Browser
Species Human (GRCh38)
Location 7:44040231-44040253
Sequence CACCCTGCTCCTGTTGGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023831290_1023831301 27 Left 1023831290 7:44040231-44040253 CCTTGGCCAACAGGAGCAGGGTG No data
Right 1023831301 7:44040281-44040303 TCCCGCAGGTGGAAGAGCTTGGG No data
1023831290_1023831296 1 Left 1023831290 7:44040231-44040253 CCTTGGCCAACAGGAGCAGGGTG No data
Right 1023831296 7:44040255-44040277 GGCTGGTGCGGGCGTCCGCGTGG No data
1023831290_1023831297 13 Left 1023831290 7:44040231-44040253 CCTTGGCCAACAGGAGCAGGGTG No data
Right 1023831297 7:44040267-44040289 CGTCCGCGTGGCGCTCCCGCAGG No data
1023831290_1023831299 16 Left 1023831290 7:44040231-44040253 CCTTGGCCAACAGGAGCAGGGTG No data
Right 1023831299 7:44040270-44040292 CCGCGTGGCGCTCCCGCAGGTGG No data
1023831290_1023831300 26 Left 1023831290 7:44040231-44040253 CCTTGGCCAACAGGAGCAGGGTG No data
Right 1023831300 7:44040280-44040302 CTCCCGCAGGTGGAAGAGCTTGG No data
1023831290_1023831295 -10 Left 1023831290 7:44040231-44040253 CCTTGGCCAACAGGAGCAGGGTG No data
Right 1023831295 7:44040244-44040266 GAGCAGGGTGCGGCTGGTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023831290 Original CRISPR CACCCTGCTCCTGTTGGCCA AGG (reversed) Intergenic
No off target data available for this crispr