ID: 1023831292

View in Genome Browser
Species Human (GRCh38)
Location 7:44040237-44040259
Sequence CAGCCGCACCCTGCTCCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023831292_1023831297 7 Left 1023831292 7:44040237-44040259 CCAACAGGAGCAGGGTGCGGCTG No data
Right 1023831297 7:44040267-44040289 CGTCCGCGTGGCGCTCCCGCAGG No data
1023831292_1023831299 10 Left 1023831292 7:44040237-44040259 CCAACAGGAGCAGGGTGCGGCTG No data
Right 1023831299 7:44040270-44040292 CCGCGTGGCGCTCCCGCAGGTGG No data
1023831292_1023831301 21 Left 1023831292 7:44040237-44040259 CCAACAGGAGCAGGGTGCGGCTG No data
Right 1023831301 7:44040281-44040303 TCCCGCAGGTGGAAGAGCTTGGG No data
1023831292_1023831296 -5 Left 1023831292 7:44040237-44040259 CCAACAGGAGCAGGGTGCGGCTG No data
Right 1023831296 7:44040255-44040277 GGCTGGTGCGGGCGTCCGCGTGG No data
1023831292_1023831300 20 Left 1023831292 7:44040237-44040259 CCAACAGGAGCAGGGTGCGGCTG No data
Right 1023831300 7:44040280-44040302 CTCCCGCAGGTGGAAGAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023831292 Original CRISPR CAGCCGCACCCTGCTCCTGT TGG (reversed) Intergenic
No off target data available for this crispr