ID: 1023831297

View in Genome Browser
Species Human (GRCh38)
Location 7:44040267-44040289
Sequence CGTCCGCGTGGCGCTCCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023831292_1023831297 7 Left 1023831292 7:44040237-44040259 CCAACAGGAGCAGGGTGCGGCTG No data
Right 1023831297 7:44040267-44040289 CGTCCGCGTGGCGCTCCCGCAGG No data
1023831286_1023831297 19 Left 1023831286 7:44040225-44040247 CCCGCACCTTGGCCAACAGGAGC No data
Right 1023831297 7:44040267-44040289 CGTCCGCGTGGCGCTCCCGCAGG No data
1023831284_1023831297 27 Left 1023831284 7:44040217-44040239 CCGCAAGGCCCGCACCTTGGCCA No data
Right 1023831297 7:44040267-44040289 CGTCCGCGTGGCGCTCCCGCAGG No data
1023831287_1023831297 18 Left 1023831287 7:44040226-44040248 CCGCACCTTGGCCAACAGGAGCA No data
Right 1023831297 7:44040267-44040289 CGTCCGCGTGGCGCTCCCGCAGG No data
1023831290_1023831297 13 Left 1023831290 7:44040231-44040253 CCTTGGCCAACAGGAGCAGGGTG No data
Right 1023831297 7:44040267-44040289 CGTCCGCGTGGCGCTCCCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023831297 Original CRISPR CGTCCGCGTGGCGCTCCCGC AGG Intergenic
No off target data available for this crispr