ID: 1023835890

View in Genome Browser
Species Human (GRCh38)
Location 7:44066898-44066920
Sequence GTGAATCAACTCTTGGTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 110}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023835890_1023835900 27 Left 1023835890 7:44066898-44066920 CCTTTGACCAAGAGTTGATTCAC 0: 1
1: 0
2: 0
3: 7
4: 110
Right 1023835900 7:44066948-44066970 AGGCTCTGGCAGTCCCACAGGGG 0: 1
1: 0
2: 1
3: 24
4: 248
1023835890_1023835895 7 Left 1023835890 7:44066898-44066920 CCTTTGACCAAGAGTTGATTCAC 0: 1
1: 0
2: 0
3: 7
4: 110
Right 1023835895 7:44066928-44066950 ACTAAACATGACTGAGGACCAGG 0: 1
1: 0
2: 0
3: 6
4: 118
1023835890_1023835898 25 Left 1023835890 7:44066898-44066920 CCTTTGACCAAGAGTTGATTCAC 0: 1
1: 0
2: 0
3: 7
4: 110
Right 1023835898 7:44066946-44066968 CCAGGCTCTGGCAGTCCCACAGG 0: 1
1: 0
2: 6
3: 40
4: 317
1023835890_1023835899 26 Left 1023835890 7:44066898-44066920 CCTTTGACCAAGAGTTGATTCAC 0: 1
1: 0
2: 0
3: 7
4: 110
Right 1023835899 7:44066947-44066969 CAGGCTCTGGCAGTCCCACAGGG 0: 1
1: 0
2: 2
3: 30
4: 227
1023835890_1023835896 13 Left 1023835890 7:44066898-44066920 CCTTTGACCAAGAGTTGATTCAC 0: 1
1: 0
2: 0
3: 7
4: 110
Right 1023835896 7:44066934-44066956 CATGACTGAGGACCAGGCTCTGG 0: 1
1: 0
2: 0
3: 13
4: 208
1023835890_1023835892 1 Left 1023835890 7:44066898-44066920 CCTTTGACCAAGAGTTGATTCAC 0: 1
1: 0
2: 0
3: 7
4: 110
Right 1023835892 7:44066922-44066944 AGCCCAACTAAACATGACTGAGG 0: 1
1: 0
2: 1
3: 17
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023835890 Original CRISPR GTGAATCAACTCTTGGTCAA AGG (reversed) Intronic
909509506 1:76436026-76436048 GTGAAGCAACTCTGGGGGAAAGG - Intronic
910174269 1:84412403-84412425 GTGAATGAGCTCCTGGTGAAAGG - Exonic
910813569 1:91264136-91264158 GTGAATGAGCTCCTGGTCACTGG + Intronic
913567744 1:120090043-120090065 GTGAATAAACTCTTTTTCTATGG + Intergenic
914288492 1:146250752-146250774 GTGAATAAACTCTTTTTCTATGG + Intergenic
914549527 1:148701496-148701518 GTGAATAAACTCTTTTTCTATGG + Intergenic
914617154 1:149370220-149370242 GTGAATAAACTCTTTTTCTATGG - Intergenic
921469010 1:215526214-215526236 ATGAATAAACTATTGGACAATGG + Intergenic
923681876 1:236124954-236124976 GTTCAGCTACTCTTGGTCAATGG + Intergenic
924564515 1:245185664-245185686 GTGAATAAACTGGTGGTAAATGG - Intronic
1065194792 10:23253385-23253407 GTGAACCACCTCTTTGTCCAGGG + Intergenic
1070085219 10:73230458-73230480 GTGAATGATCTCTTGGTTCATGG + Exonic
1071282768 10:84117552-84117574 GTGAATGCACACTTGGACAAGGG - Intergenic
1071282869 10:84118667-84118689 GTGAATGCACACTTGGACAAGGG + Intergenic
1071619221 10:87103830-87103852 GTTTATCAACTCTTGGTTAAGGG + Intronic
1072801714 10:98396878-98396900 GTGAGGCAACCCTTGGCCAATGG + Intronic
1074614742 10:115056361-115056383 GGCAATCCACTCTTGGTCACAGG + Intergenic
1075494556 10:122908715-122908737 GTGAAGCAACTCTTCCTCCATGG + Intergenic
1081151887 11:39642892-39642914 GTAAATCATCTCTTTGTCTAGGG + Intergenic
1081372788 11:42324502-42324524 TTGAATCAATTATTAGTCAATGG + Intergenic
1086998275 11:93384627-93384649 GTGATTCAACCCTTGCCCAATGG - Intronic
1088443075 11:109893323-109893345 GGTAAGCAACTCTTGGTTAAAGG + Intergenic
1088590419 11:111398253-111398275 CTGAAACTACACTTGGTCAATGG - Intronic
1088849791 11:113695377-113695399 GTGAGTCATATCTTGGTCTAGGG - Intronic
1091801488 12:3327386-3327408 TTGAATCAACTCTACGCCAATGG - Intergenic
1097305652 12:58066381-58066403 GAGACTCAACACTTGGTCATGGG + Intergenic
1098044746 12:66388865-66388887 GTGGATACACTCTTGGACAAAGG - Intronic
1098944715 12:76576741-76576763 CTGAATAACCACTTGGTCAAAGG + Intergenic
1101425912 12:104588483-104588505 GTGACTCAAGTCTGGGTCATAGG - Intronic
1105938081 13:25120304-25120326 GTGAATCACCCCTTGGGCAATGG + Intergenic
1110673830 13:78214635-78214657 AGGAATCAACTTTTGGTAAAGGG - Intergenic
1111351390 13:87036051-87036073 ATGGATCCACTCTTGGCCAAGGG + Intergenic
1114233987 14:20808650-20808672 GTGGATATACTCTTGGTCAAGGG - Intergenic
1115020548 14:28674977-28674999 GGGAATCAAATCTGGGTTAATGG - Intergenic
1116077079 14:40124746-40124768 GTAAATCAAGTCATGGTTAATGG - Intergenic
1117334736 14:54747391-54747413 GTGAACCAACTCTAGGTTTAGGG - Intronic
1117833064 14:59772909-59772931 GTGAATGAACTCCAGGTAAATGG + Intronic
1127467440 15:59257968-59257990 GTGAATCTATTCTTGTTCCAGGG - Intronic
1136928710 16:34399071-34399093 GGGAATCAGATATTGGTCAAAGG - Intergenic
1136975864 16:35012733-35012755 GGGAATCAGATATTGGTCAAAGG + Intergenic
1138112948 16:54339044-54339066 GTGAATAAAATCCTGGTCTATGG + Intergenic
1138717597 16:59042290-59042312 ATGGATCATCTCTTGGCCAAGGG + Intergenic
1144614659 17:16757804-16757826 GGGAAGCTACTCTAGGTCAAAGG - Intronic
1144898047 17:18557870-18557892 GGGAAACTACTCTAGGTCAAAGG + Intergenic
1145134323 17:20387844-20387866 GGGAAACTACTCTAGGTCAAAGG - Intergenic
1149702502 17:58667130-58667152 GTGAATGAACTTTTAGTCACGGG + Intronic
1152435325 17:80272960-80272982 GTGAATCCACTCGTGGACATTGG + Intronic
1153979843 18:10299321-10299343 TGGAAGCAACTCTAGGTCAAGGG + Intergenic
1159709429 18:71737105-71737127 CTGAATCCTCTCTTGCTCAAGGG - Intronic
1159849797 18:73514475-73514497 CTGAATAAAATCTTGGGCAAAGG - Intergenic
1164875646 19:31684853-31684875 GTGATTCCAATCTTAGTCAATGG + Intergenic
1166867436 19:45848534-45848556 GTGAATAAACGGATGGTCAATGG + Intronic
931284855 2:60823430-60823452 ATGGACCCACTCTTGGTCAAGGG - Intergenic
936639546 2:114296806-114296828 CTGAATGAACCCTTGGCCAAGGG - Intergenic
939131748 2:138243480-138243502 CTGAACCTATTCTTGGTCAAAGG - Intergenic
944202756 2:197125443-197125465 GTCAATTTACTCTTGGCCAAAGG - Exonic
947647980 2:231758700-231758722 GTAAATCACCTTTTGCTCAAGGG - Intronic
948051960 2:234985278-234985300 GTGACTCAAATCTTGGTGGATGG - Intronic
1173587981 20:44198931-44198953 GTGAATCATCCCTTCGTCCAGGG + Intronic
1182411046 22:30186752-30186774 GGCTATCAACTCTTGGGCAAGGG + Intergenic
1182597985 22:31436902-31436924 TTGAATCAATTGTTGGTAAAGGG + Intronic
1184286482 22:43474620-43474642 CTGCATGAACTCCTGGTCAAAGG - Intronic
1185358035 22:50386773-50386795 GTGACTAAACTCTGGGTAAATGG - Intronic
951367685 3:21804478-21804500 TTGAATCATCTCTTGTTCATAGG - Intronic
951400793 3:22229650-22229672 CTCAAGCCACTCTTGGTCAAAGG + Intronic
955291963 3:57700539-57700561 GTGAATCATCCCTTTGTCCACGG + Intergenic
958193536 3:90213281-90213303 GAAAAACAACACTTGGTCAAGGG + Intergenic
958416847 3:93884188-93884210 GAAAAACAACACTTGGTCAAGGG + Intronic
961243251 3:125430451-125430473 ATGAACCATCTCTTGGCCAAGGG + Intergenic
961706248 3:128788078-128788100 GTGAATCATCGCTTTGTCCAGGG + Intronic
964854992 3:161137140-161137162 ATGGATCCACTCTTGGCCAAGGG - Intronic
965680440 3:171245731-171245753 GTGAGTAAATTCTTGGACAAAGG - Intronic
966751283 3:183324476-183324498 GAAAATTAACTCTTGGTCAGAGG + Intronic
966934782 3:184698978-184699000 CTGAATCATGTCTTGGACAAGGG - Intergenic
971390937 4:26184628-26184650 CTGAGTCAAGTTTTGGTCAAAGG + Intronic
971785430 4:31096285-31096307 GTGACTCAAAACTTGGTAAAAGG - Intronic
973733014 4:53841925-53841947 GTGGTTCAACTCTTGCTCCAGGG + Intronic
974136505 4:57825190-57825212 GGGAACCCTCTCTTGGTCAAGGG - Intergenic
975644663 4:76534416-76534438 GTCAAGAAATTCTTGGTCAAGGG - Intronic
979253292 4:118587413-118587435 GTGATTTAACACTTGGTAAATGG + Intergenic
980025880 4:127765996-127766018 GTCAAGGAATTCTTGGTCAAGGG + Intronic
980132149 4:128826834-128826856 GTGACTAAAGTTTTGGTCAAAGG - Intronic
981108389 4:140906797-140906819 GGGAACCAACTCTTGGCCCATGG - Intronic
981716373 4:147756622-147756644 GTGAATCATCCCTTTGTCCAGGG + Intronic
984134363 4:175916998-175917020 GTAAATCAACCCTGGGTCTATGG - Intronic
984243779 4:177250029-177250051 GTGAATTATCTCTTGGTAAGAGG - Intergenic
984434897 4:179696923-179696945 GTGAATCATGTTTTGGTCAAAGG + Intergenic
984789910 4:183605875-183605897 GTTCATCAACTCTTGTTCAAGGG + Intergenic
987230486 5:15888774-15888796 GTTAATAAACTCTTGATCGAAGG - Intronic
988517350 5:31916429-31916451 GTCATTCAACCCTTGCTCAAGGG - Intronic
988863735 5:35311758-35311780 TTGAAACAACTCTAGTTCAAAGG + Intergenic
996766325 5:127037504-127037526 GTAAATGAACTCTTGGTCGTGGG + Intergenic
997085659 5:130795178-130795200 GTGAATCATCCCTTTGTCCAGGG - Intergenic
1000165296 5:158642526-158642548 GTGAATAAACTATTTATCAAGGG - Intergenic
1003877479 6:10451309-10451331 TTGATTAAACTCTTGGTCATTGG - Intergenic
1005589203 6:27307610-27307632 GGGAATGAGCTGTTGGTCAAAGG - Intronic
1007334139 6:41139357-41139379 GTGAATCAGGTGTTAGTCAAAGG - Intergenic
1011871685 6:91902167-91902189 CTGAATGAGCTCCTGGTCAAGGG - Intergenic
1012602606 6:101116285-101116307 GTGGATCAGTTCTTAGTCAAAGG + Intergenic
1012657703 6:101846397-101846419 GAGAATCATCTCTTGAACAAAGG - Intronic
1015280895 6:131433099-131433121 GTGAATCATCCCTTTGTCCAGGG - Intergenic
1017824241 6:158069991-158070013 GTTACTCAGCTCTTGGTCAGAGG - Intronic
1018281753 6:162193692-162193714 GTGAATCAGCCTTTGGTGAATGG - Intronic
1020972070 7:14956553-14956575 GTGTATGAATTCTTGGTTAAAGG - Intronic
1023608949 7:41955229-41955251 GTGAAGAAACTCTGGGTCAAGGG + Intergenic
1023835890 7:44066898-44066920 GTGAATCAACTCTTGGTCAAAGG - Intronic
1026848936 7:73712847-73712869 GTGGAACAACTCTTGGGCAGGGG - Intronic
1028387210 7:90269496-90269518 GTGAATCAAATATTTGACAAAGG + Intronic
1028948342 7:96605910-96605932 GAGAATCATCTCTTTGTCAAGGG + Intronic
1029339410 7:99930868-99930890 GTGAATCATCCCTTTGTCCAGGG + Intergenic
1030205789 7:106951488-106951510 GTGAATTAACTCTGGCCCAAGGG - Intergenic
1052975543 9:34407265-34407287 GTGAATCTACTCTTATTAAAGGG - Intronic
1052975892 9:34409789-34409811 GTGAATCTACTCTTATTAAAGGG - Intronic
1053111272 9:35461732-35461754 GTGAATGCACACTTGGACAAGGG + Intergenic
1059219580 9:112601527-112601549 TGGAATCAACTTATGGTCAAAGG - Intronic
1187558536 X:20377034-20377056 GTGAATCAGCTTTTGTGCAAGGG - Intergenic
1190855752 X:54292935-54292957 GTGAAACAACTGTCGGTCCAAGG + Exonic
1198650475 X:138858261-138858283 ACGAAACAACGCTTGGTCAAAGG + Intronic